ID: 1125360020

View in Genome Browser
Species Human (GRCh38)
Location 15:38855254-38855276
Sequence CTACTGTACCATCACTCCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125360012_1125360020 4 Left 1125360012 15:38855227-38855249 CCCTCTTTTCCTAGATTCCCTGT No data
Right 1125360020 15:38855254-38855276 CTACTGTACCATCACTCCACTGG No data
1125360011_1125360020 9 Left 1125360011 15:38855222-38855244 CCAGACCCTCTTTTCCTAGATTC No data
Right 1125360020 15:38855254-38855276 CTACTGTACCATCACTCCACTGG No data
1125360014_1125360020 -5 Left 1125360014 15:38855236-38855258 CCTAGATTCCCTGTGCCCCTACT No data
Right 1125360020 15:38855254-38855276 CTACTGTACCATCACTCCACTGG No data
1125360013_1125360020 3 Left 1125360013 15:38855228-38855250 CCTCTTTTCCTAGATTCCCTGTG No data
Right 1125360020 15:38855254-38855276 CTACTGTACCATCACTCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125360020 Original CRISPR CTACTGTACCATCACTCCAC TGG Intergenic
No off target data available for this crispr