ID: 1125360939

View in Genome Browser
Species Human (GRCh38)
Location 15:38864352-38864374
Sequence GACCTGGAGCTACCCACACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125360939_1125360941 -1 Left 1125360939 15:38864352-38864374 CCTGGTGTGGGTAGCTCCAGGTC No data
Right 1125360941 15:38864374-38864396 CAATGAATATCAAAGCCAAGAGG No data
1125360939_1125360943 15 Left 1125360939 15:38864352-38864374 CCTGGTGTGGGTAGCTCCAGGTC No data
Right 1125360943 15:38864390-38864412 CAAGAGGAATAAAAAGTTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125360939 Original CRISPR GACCTGGAGCTACCCACACC AGG (reversed) Intergenic
No off target data available for this crispr