ID: 1125361224

View in Genome Browser
Species Human (GRCh38)
Location 15:38866728-38866750
Sequence TCCCACGGTATACACCCCTA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125361222_1125361224 -9 Left 1125361222 15:38866714-38866736 CCTCTCCAGTGGGCTCCCACGGT No data
Right 1125361224 15:38866728-38866750 TCCCACGGTATACACCCCTACGG No data
1125361215_1125361224 20 Left 1125361215 15:38866685-38866707 CCTGCTTATTTCTCAGGCTCTAT No data
Right 1125361224 15:38866728-38866750 TCCCACGGTATACACCCCTACGG No data
1125361219_1125361224 -7 Left 1125361219 15:38866712-38866734 CCCCTCTCCAGTGGGCTCCCACG No data
Right 1125361224 15:38866728-38866750 TCCCACGGTATACACCCCTACGG No data
1125361214_1125361224 21 Left 1125361214 15:38866684-38866706 CCCTGCTTATTTCTCAGGCTCTA No data
Right 1125361224 15:38866728-38866750 TCCCACGGTATACACCCCTACGG No data
1125361218_1125361224 -3 Left 1125361218 15:38866708-38866730 CCTGCCCCTCTCCAGTGGGCTCC No data
Right 1125361224 15:38866728-38866750 TCCCACGGTATACACCCCTACGG No data
1125361220_1125361224 -8 Left 1125361220 15:38866713-38866735 CCCTCTCCAGTGGGCTCCCACGG No data
Right 1125361224 15:38866728-38866750 TCCCACGGTATACACCCCTACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125361224 Original CRISPR TCCCACGGTATACACCCCTA CGG Intergenic