ID: 1125361530

View in Genome Browser
Species Human (GRCh38)
Location 15:38869649-38869671
Sequence AAGGCTAAACTTATGGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125361530_1125361537 30 Left 1125361530 15:38869649-38869671 CCCACCTCCATAAGTTTAGCCTT No data
Right 1125361537 15:38869702-38869724 GATATTTGTCTTTCTGTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125361530 Original CRISPR AAGGCTAAACTTATGGAGGT GGG (reversed) Intergenic
No off target data available for this crispr