ID: 1125361921

View in Genome Browser
Species Human (GRCh38)
Location 15:38873419-38873441
Sequence CAGCTAAAAGACTCTGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125361919_1125361921 7 Left 1125361919 15:38873389-38873411 CCTGTCTCTTATGCTAATATTTG No data
Right 1125361921 15:38873419-38873441 CAGCTAAAAGACTCTGAGGAAGG No data
1125361918_1125361921 8 Left 1125361918 15:38873388-38873410 CCCTGTCTCTTATGCTAATATTT No data
Right 1125361921 15:38873419-38873441 CAGCTAAAAGACTCTGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125361921 Original CRISPR CAGCTAAAAGACTCTGAGGA AGG Intergenic
No off target data available for this crispr