ID: 1125362016

View in Genome Browser
Species Human (GRCh38)
Location 15:38874398-38874420
Sequence GGTGTATTTTGACTAAAACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125362014_1125362016 -7 Left 1125362014 15:38874382-38874404 CCAGAATTACTAAGCTGGTGTAT No data
Right 1125362016 15:38874398-38874420 GGTGTATTTTGACTAAAACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125362016 Original CRISPR GGTGTATTTTGACTAAAACA GGG Intergenic
No off target data available for this crispr