ID: 1125363581

View in Genome Browser
Species Human (GRCh38)
Location 15:38889950-38889972
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125363581_1125363585 30 Left 1125363581 15:38889950-38889972 CCGTAGGTCCACCTCTGTTTGAC No data
Right 1125363585 15:38890003-38890025 AATATTGACAATTTATTGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125363581 Original CRISPR GTCAAACAGAGGTGGACCTA CGG (reversed) Intergenic
No off target data available for this crispr