ID: 1125363585

View in Genome Browser
Species Human (GRCh38)
Location 15:38890003-38890025
Sequence AATATTGACAATTTATTGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125363583_1125363585 19 Left 1125363583 15:38889961-38889983 CCTCTGTTTGACGCATGACCTGT No data
Right 1125363585 15:38890003-38890025 AATATTGACAATTTATTGATAGG No data
1125363584_1125363585 1 Left 1125363584 15:38889979-38890001 CCTGTTCTGATTTGAGATTTAGA No data
Right 1125363585 15:38890003-38890025 AATATTGACAATTTATTGATAGG No data
1125363581_1125363585 30 Left 1125363581 15:38889950-38889972 CCGTAGGTCCACCTCTGTTTGAC No data
Right 1125363585 15:38890003-38890025 AATATTGACAATTTATTGATAGG No data
1125363582_1125363585 22 Left 1125363582 15:38889958-38889980 CCACCTCTGTTTGACGCATGACC No data
Right 1125363585 15:38890003-38890025 AATATTGACAATTTATTGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125363585 Original CRISPR AATATTGACAATTTATTGAT AGG Intergenic