ID: 1125364661

View in Genome Browser
Species Human (GRCh38)
Location 15:38901187-38901209
Sequence GTGGAAATTCCCGACTTTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125364656_1125364661 27 Left 1125364656 15:38901137-38901159 CCTGGAACAATTGGCTGCAGATG No data
Right 1125364661 15:38901187-38901209 GTGGAAATTCCCGACTTTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125364661 Original CRISPR GTGGAAATTCCCGACTTTGT AGG Intergenic
No off target data available for this crispr