ID: 1125365318

View in Genome Browser
Species Human (GRCh38)
Location 15:38907979-38908001
Sequence CAGTTGGCCTGGAGTGATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125365318_1125365321 -5 Left 1125365318 15:38907979-38908001 CCATCATCACTCCAGGCCAACTG No data
Right 1125365321 15:38907997-38908019 AACTGATCATTACCACCTGCTGG No data
1125365318_1125365324 17 Left 1125365318 15:38907979-38908001 CCATCATCACTCCAGGCCAACTG No data
Right 1125365324 15:38908019-38908041 GAATACTGAACTTTCCTAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125365318 Original CRISPR CAGTTGGCCTGGAGTGATGA TGG (reversed) Intergenic
No off target data available for this crispr