ID: 1125376960

View in Genome Browser
Species Human (GRCh38)
Location 15:39040337-39040359
Sequence GACACATATGTAAATGCATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125376957_1125376960 4 Left 1125376957 15:39040310-39040332 CCAAACTTCAAAACATACCCAAA No data
Right 1125376960 15:39040337-39040359 GACACATATGTAAATGCATGAGG No data
1125376956_1125376960 18 Left 1125376956 15:39040296-39040318 CCACATCTGTTATTCCAAACTTC No data
Right 1125376960 15:39040337-39040359 GACACATATGTAAATGCATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125376960 Original CRISPR GACACATATGTAAATGCATG AGG Intergenic
No off target data available for this crispr