ID: 1125381593

View in Genome Browser
Species Human (GRCh38)
Location 15:39092430-39092452
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125381593_1125381599 -5 Left 1125381593 15:39092430-39092452 CCCAGCCTCCAGCCTTCAGACCC No data
Right 1125381599 15:39092448-39092470 GACCCTCCCTGGCCTGAAGCCGG No data
1125381593_1125381605 6 Left 1125381593 15:39092430-39092452 CCCAGCCTCCAGCCTTCAGACCC No data
Right 1125381605 15:39092459-39092481 GCCTGAAGCCGGGTTCTCACTGG No data
1125381593_1125381609 29 Left 1125381593 15:39092430-39092452 CCCAGCCTCCAGCCTTCAGACCC No data
Right 1125381609 15:39092482-39092504 GAACCCGCCCACTTCTGCCCAGG No data
1125381593_1125381607 7 Left 1125381593 15:39092430-39092452 CCCAGCCTCCAGCCTTCAGACCC No data
Right 1125381607 15:39092460-39092482 CCTGAAGCCGGGTTCTCACTGGG No data
1125381593_1125381600 -4 Left 1125381593 15:39092430-39092452 CCCAGCCTCCAGCCTTCAGACCC No data
Right 1125381600 15:39092449-39092471 ACCCTCCCTGGCCTGAAGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125381593 Original CRISPR GGGTCTGAAGGCTGGAGGCT GGG (reversed) Intergenic