ID: 1125381598

View in Genome Browser
Species Human (GRCh38)
Location 15:39092442-39092464
Sequence TCAGGCCAGGGAGGGTCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125381598_1125381607 -5 Left 1125381598 15:39092442-39092464 CCTTCAGACCCTCCCTGGCCTGA No data
Right 1125381607 15:39092460-39092482 CCTGAAGCCGGGTTCTCACTGGG No data
1125381598_1125381605 -6 Left 1125381598 15:39092442-39092464 CCTTCAGACCCTCCCTGGCCTGA No data
Right 1125381605 15:39092459-39092481 GCCTGAAGCCGGGTTCTCACTGG No data
1125381598_1125381609 17 Left 1125381598 15:39092442-39092464 CCTTCAGACCCTCCCTGGCCTGA No data
Right 1125381609 15:39092482-39092504 GAACCCGCCCACTTCTGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125381598 Original CRISPR TCAGGCCAGGGAGGGTCTGA AGG (reversed) Intergenic