ID: 1125381605

View in Genome Browser
Species Human (GRCh38)
Location 15:39092459-39092481
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125381598_1125381605 -6 Left 1125381598 15:39092442-39092464 CCTTCAGACCCTCCCTGGCCTGA No data
Right 1125381605 15:39092459-39092481 GCCTGAAGCCGGGTTCTCACTGG No data
1125381597_1125381605 -2 Left 1125381597 15:39092438-39092460 CCAGCCTTCAGACCCTCCCTGGC No data
Right 1125381605 15:39092459-39092481 GCCTGAAGCCGGGTTCTCACTGG No data
1125381594_1125381605 5 Left 1125381594 15:39092431-39092453 CCAGCCTCCAGCCTTCAGACCCT No data
Right 1125381605 15:39092459-39092481 GCCTGAAGCCGGGTTCTCACTGG No data
1125381593_1125381605 6 Left 1125381593 15:39092430-39092452 CCCAGCCTCCAGCCTTCAGACCC No data
Right 1125381605 15:39092459-39092481 GCCTGAAGCCGGGTTCTCACTGG No data
1125381592_1125381605 26 Left 1125381592 15:39092410-39092432 CCAGTCTGCATGACTGGCAGCCC No data
Right 1125381605 15:39092459-39092481 GCCTGAAGCCGGGTTCTCACTGG No data
1125381595_1125381605 1 Left 1125381595 15:39092435-39092457 CCTCCAGCCTTCAGACCCTCCCT No data
Right 1125381605 15:39092459-39092481 GCCTGAAGCCGGGTTCTCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125381605 Original CRISPR GCCTGAAGCCGGGTTCTCAC TGG Intergenic
No off target data available for this crispr