ID: 1125381692

View in Genome Browser
Species Human (GRCh38)
Location 15:39092862-39092884
Sequence CAGCTGCAGCACCTAAACCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125381692_1125381704 26 Left 1125381692 15:39092862-39092884 CCATGGTTTAGGTGCTGCAGCTG No data
Right 1125381704 15:39092911-39092933 TGCCTACCCTGGGGAGCAGGAGG No data
1125381692_1125381699 -1 Left 1125381692 15:39092862-39092884 CCATGGTTTAGGTGCTGCAGCTG No data
Right 1125381699 15:39092884-39092906 GTGCAGCGGTGGTGGGGAGAGGG No data
1125381692_1125381703 23 Left 1125381692 15:39092862-39092884 CCATGGTTTAGGTGCTGCAGCTG No data
Right 1125381703 15:39092908-39092930 TGCTGCCTACCCTGGGGAGCAGG No data
1125381692_1125381700 15 Left 1125381692 15:39092862-39092884 CCATGGTTTAGGTGCTGCAGCTG No data
Right 1125381700 15:39092900-39092922 GAGAGGGCTGCTGCCTACCCTGG No data
1125381692_1125381696 -8 Left 1125381692 15:39092862-39092884 CCATGGTTTAGGTGCTGCAGCTG No data
Right 1125381696 15:39092877-39092899 TGCAGCTGTGCAGCGGTGGTGGG No data
1125381692_1125381701 16 Left 1125381692 15:39092862-39092884 CCATGGTTTAGGTGCTGCAGCTG No data
Right 1125381701 15:39092901-39092923 AGAGGGCTGCTGCCTACCCTGGG No data
1125381692_1125381698 -2 Left 1125381692 15:39092862-39092884 CCATGGTTTAGGTGCTGCAGCTG No data
Right 1125381698 15:39092883-39092905 TGTGCAGCGGTGGTGGGGAGAGG No data
1125381692_1125381702 17 Left 1125381692 15:39092862-39092884 CCATGGTTTAGGTGCTGCAGCTG No data
Right 1125381702 15:39092902-39092924 GAGGGCTGCTGCCTACCCTGGGG No data
1125381692_1125381697 -7 Left 1125381692 15:39092862-39092884 CCATGGTTTAGGTGCTGCAGCTG No data
Right 1125381697 15:39092878-39092900 GCAGCTGTGCAGCGGTGGTGGGG No data
1125381692_1125381695 -9 Left 1125381692 15:39092862-39092884 CCATGGTTTAGGTGCTGCAGCTG No data
Right 1125381695 15:39092876-39092898 CTGCAGCTGTGCAGCGGTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125381692 Original CRISPR CAGCTGCAGCACCTAAACCA TGG (reversed) Intergenic
No off target data available for this crispr