ID: 1125381703

View in Genome Browser
Species Human (GRCh38)
Location 15:39092908-39092930
Sequence TGCTGCCTACCCTGGGGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125381692_1125381703 23 Left 1125381692 15:39092862-39092884 CCATGGTTTAGGTGCTGCAGCTG No data
Right 1125381703 15:39092908-39092930 TGCTGCCTACCCTGGGGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125381703 Original CRISPR TGCTGCCTACCCTGGGGAGC AGG Intergenic
No off target data available for this crispr