ID: 1125388744

View in Genome Browser
Species Human (GRCh38)
Location 15:39168818-39168840
Sequence GCACCTGTATTTTATCTGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 176}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125388741_1125388744 21 Left 1125388741 15:39168774-39168796 CCTGTTGTGTTGCTTTGGTGAGC 0: 1
1: 0
2: 0
3: 10
4: 115
Right 1125388744 15:39168818-39168840 GCACCTGTATTTTATCTGCATGG 0: 1
1: 0
2: 0
3: 12
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125388744 Original CRISPR GCACCTGTATTTTATCTGCA TGG Intergenic
901823416 1:11845044-11845066 GAACTTGTAGTTTGTCTGCATGG + Intergenic
907340247 1:53730291-53730313 GCACGTGTAATTTATTTACAGGG + Intronic
909466131 1:75976113-75976135 ACACCAGTGTTTTATCTGCCTGG + Intergenic
909652527 1:77991814-77991836 ACACCTGAATTTTCTCTGTAAGG - Intronic
911657978 1:100466320-100466342 TCACCTGTGTTTTATCTATACGG + Intronic
912179385 1:107199979-107200001 GCACCAGTTTTTGATCTTCATGG + Intronic
917035075 1:170740036-170740058 GGACTTGAATTTTATCAGCAAGG + Intergenic
920587211 1:207177971-207177993 GCACCTGAATTCTTTCTTCATGG + Intergenic
921417936 1:214912298-214912320 GTGCCTGTATTCTAACTGCAAGG - Intergenic
921644000 1:217590700-217590722 ACACATGTATATTATCTGCCTGG + Intronic
923080426 1:230648157-230648179 GCACATGCATTTTATCAGTAGGG + Intronic
923115620 1:230934963-230934985 GCACCTTGATTTTCTCTGGAAGG + Intronic
923958173 1:239045935-239045957 GAGGCTGTATTTTTTCTGCAGGG - Intergenic
924692660 1:246366477-246366499 GCCCAAGTATTTTCTCTGCAGGG - Intronic
1065172168 10:23042316-23042338 CCACCTGTCATTTATATGCATGG - Intergenic
1065740674 10:28794308-28794330 GCACCTGTAATCCATCTGCTTGG - Intergenic
1066270408 10:33817064-33817086 GCACCTCTATTTTGTCAACATGG + Intergenic
1067067395 10:43111627-43111649 GGTCCTGTATGTTATCTGGAAGG - Intronic
1068960697 10:62863801-62863823 GCACCTGTGTTTTATTCCCAGGG + Intronic
1070496301 10:77027098-77027120 TCATCTCTATTTTATCTGTAAGG + Intronic
1071977407 10:90968853-90968875 GCACCTGCAATTTGTCTCCAGGG + Intergenic
1073968637 10:109020851-109020873 GCAGCTCTATTTTATCACCAAGG - Intergenic
1075588447 10:123674302-123674324 GCAGGTGTGTTTTACCTGCAAGG - Intronic
1077461444 11:2712764-2712786 GCTCCTGCACTTTTTCTGCACGG + Intronic
1081297104 11:41404715-41404737 GTACCTGTATTTTTTCTCCCTGG - Intronic
1085168100 11:74422883-74422905 GCATCAGTCTTTTATCTGCAGGG + Intergenic
1087351335 11:97036380-97036402 GCACTTACATTTTAGCTGCAGGG + Intergenic
1087976453 11:104554726-104554748 ACACATATATTTTCTCTGCAAGG - Intergenic
1089994087 11:122888219-122888241 GAACCTGTATTCTCTCTGCCTGG - Intronic
1091129978 11:133137911-133137933 GAACCTGTATTTTAGCTTCTTGG - Intronic
1093034095 12:14316741-14316763 GCATCTTTACTTAATCTGCATGG + Intergenic
1093273067 12:17090058-17090080 GCACCTGTTTTTTTTCTCCATGG - Intergenic
1095989025 12:48021427-48021449 GGACCTGTAGTTAAGCTGCATGG - Intronic
1096313921 12:50546668-50546690 GCACCTATTATCTATCTGCAAGG - Intronic
1097282210 12:57852083-57852105 GCACTTGAATTGTATCTTCAAGG - Intergenic
1097349220 12:58529391-58529413 ACACATGTATTTTCTCTGTAAGG - Intergenic
1097875946 12:64643405-64643427 GCACCTGTAGTCCAGCTGCATGG + Intronic
1100519520 12:95360038-95360060 CCACGTGTATTTTTTCTGTAAGG - Intergenic
1101129407 12:101673247-101673269 TAATCTGTATTTTATGTGCAAGG - Intronic
1105616792 13:22026209-22026231 GCACATGTATTTCCTCTGCCTGG + Intergenic
1108339287 13:49481372-49481394 GCACATTTGTTTTGTCTGCATGG + Intronic
1112905167 13:104408787-104408809 CCATCTGTATTTTTTCTTCAGGG - Intergenic
1113596847 13:111539724-111539746 GCACCTGTAGTTTCTCTCCCCGG + Intergenic
1116392026 14:44404242-44404264 GTGCCAGTATTTTATCTGGATGG + Intergenic
1118283654 14:64451431-64451453 GTAAGTGTATTATATCTGCAAGG - Intronic
1121608752 14:95261086-95261108 ACACATGTATTTTCTCCGCAAGG + Intronic
1121664840 14:95664620-95664642 GCACCTGCAGTTTACCAGCAGGG - Intergenic
1125175002 15:36811144-36811166 GTACCTGTTCATTATCTGCAAGG + Intergenic
1125182753 15:36896095-36896117 TCACATGTATTTTAGCAGCATGG + Intronic
1125388744 15:39168818-39168840 GCACCTGTATTTTATCTGCATGG + Intergenic
1125690980 15:41596006-41596028 GCACCTGGCTATTATCAGCAAGG + Intergenic
1126478774 15:49094715-49094737 TCAACAGTATCTTATCTGCAAGG - Intergenic
1127337802 15:58007018-58007040 ACACATGTATTTTCTCTGTAAGG - Intronic
1127423346 15:58830619-58830641 GCACATGTATTTTCTCTATAAGG + Intronic
1128933002 15:71722197-71722219 GCAGCTGTTTTTGATATGCAAGG + Intronic
1130763098 15:86841204-86841226 ACACTTGTATTTTATCTGTTTGG - Intronic
1131667663 15:94587550-94587572 GCACCTCCAATTGATCTGCACGG - Intergenic
1133679362 16:8106589-8106611 TCACCTGTATTTTATAGGCGAGG - Intergenic
1135959698 16:26985412-26985434 GCACCTGTTTTTCATCAGCAAGG - Intergenic
1137723845 16:50643852-50643874 GCACACATATTTTCTCTGCAAGG + Intergenic
1137856056 16:51795732-51795754 GCATCTTTTTTTTATCAGCAGGG - Intergenic
1138345968 16:56320393-56320415 GCACCATCATTTTCTCTGCAAGG - Intronic
1139371572 16:66472361-66472383 GCCACTGTATTTTATCCTCAAGG + Intronic
1139451322 16:67029719-67029741 GCCCGTGTACTTAATCTGCAAGG - Exonic
1140332977 16:74075777-74075799 TCACCTATTTTCTATCTGCATGG - Intergenic
1142430150 16:90022026-90022048 GCAGCTGTTTGTTTTCTGCAGGG + Intronic
1144760151 17:17702528-17702550 TCACCTCCATTTTGTCTGCAAGG - Intronic
1147978346 17:44260400-44260422 GCACCTGTGTTTAAGCAGCAGGG + Exonic
1150707817 17:67503503-67503525 GCCCTTGTATTTTCTCTGTAGGG + Intronic
1150838416 17:68585627-68585649 GAACCTGGATTTTTTCAGCAGGG - Intronic
1153292119 18:3511777-3511799 GAACATATATTTTATCTGTAGGG - Intronic
1153765328 18:8369161-8369183 GCACATATATTTTATGTTCAAGG - Intronic
1154495014 18:14949467-14949489 TCATCTGTATTTTATGTGTAAGG - Intergenic
1156701312 18:39828981-39829003 GCATGTCTATTTTATGTGCAGGG - Intergenic
1159102902 18:63974863-63974885 GCACATGTATTGTGGCTGCAGGG + Intronic
1159726328 18:71964924-71964946 ACATCTGTGTCTTATCTGCATGG + Intergenic
1159890943 18:73952638-73952660 GCACCTGGATCTTTTCTGAAAGG - Intergenic
1163352734 19:16788679-16788701 GCAGATGTATTTTTTCTGTAAGG + Intronic
1164027125 19:21362610-21362632 TCACCTGTTTTTTAGCTGTAAGG + Intronic
1164162819 19:22640286-22640308 GCACCTGTAATTCAGCTGCTTGG - Intronic
1164539295 19:29110591-29110613 GCATATCTATTTTCTCTGCAAGG + Intergenic
1164837041 19:31362945-31362967 GCACCTTTTTTATATCTGCGTGG + Intergenic
1166185107 19:41134676-41134698 GCACCTCTATTTGATTTCCAAGG - Intergenic
1166268201 19:41697635-41697657 CCACATGTATTGTACCTGCAGGG - Intronic
925747228 2:7053882-7053904 GCACCTGTATGGCATCGGCAGGG - Intronic
926705158 2:15832025-15832047 GCACATGTATTTCCTCTGTAAGG + Intergenic
926802385 2:16670277-16670299 ACACATGTATTTTCTCTGTAAGG + Intergenic
929084285 2:38152943-38152965 ACACATGTATTTTCTCTGTAAGG - Intergenic
930466710 2:51761877-51761899 GTAACTATATTTTATATGCATGG - Intergenic
931306135 2:61030551-61030573 ACACCTGTATTTTCTCTGTAAGG - Intronic
934528228 2:95066295-95066317 ACACATGTATTTTCTCTGCAAGG + Intergenic
935440277 2:103085809-103085831 CCAACTGGATTTTATGTGCAGGG + Intergenic
938612836 2:132966772-132966794 ACACATGTATTTTATCTGTAGGG + Intronic
1168970850 20:1929859-1929881 GCATCTGGACTTTATCTGGAGGG - Intronic
1169396304 20:5233060-5233082 GCACCTGTATCTTAGCTACTTGG + Intergenic
1169717441 20:8636160-8636182 GCACATGTATTCTACCTGCAAGG - Intronic
1172599502 20:36174020-36174042 GCTCCAGTATTTTTTCTGGAGGG + Intronic
1173402269 20:42736203-42736225 GCCCATGTATTTTCCCTGCAGGG - Intronic
1173573016 20:44090275-44090297 GCACCTTCCTTTTCTCTGCAGGG - Intergenic
1174601572 20:51729304-51729326 GCACCTGCCTTCTCTCTGCAAGG - Intronic
1175351470 20:58323776-58323798 GCACCTTTATTTTGTTTGCTGGG + Intronic
1176524003 21:7851512-7851534 GCAAATGTAATTTATCTTCAAGG - Intergenic
1177037992 21:16069365-16069387 TCCCCTTTATTTTACCTGCAAGG + Intergenic
1178658023 21:34481525-34481547 GCAAATGTAATTTATCTTCAAGG - Intergenic
1181783339 22:25208408-25208430 GCACCTGTTATTTCTCTGCCTGG - Intergenic
1183338311 22:37263772-37263794 GCACCTGTATTAATTCTCCAGGG - Intergenic
1184160998 22:42697375-42697397 GCCCCTGTCTTTCTTCTGCAGGG + Intronic
949179204 3:1106817-1106839 TCACATGTATTTTTACTGCATGG + Intronic
949781747 3:7697316-7697338 GCATCTTTTTTTTATCTTCAGGG + Intronic
950239354 3:11354128-11354150 ACCCTTGCATTTTATCTGCATGG + Intronic
955760107 3:62271078-62271100 GCACTTGTACTTTTCCTGCAAGG - Intronic
956274775 3:67486639-67486661 GCACCTGTATGCTCTCTGTAGGG + Intronic
961077518 3:123995680-123995702 GCACTTGCATTTCATCTGCCTGG + Intergenic
961307062 3:125965605-125965627 GCACTTGCATTTTGTCTGCCTGG - Intergenic
962183960 3:133238693-133238715 GCTCATGTATTTTGTCTTCATGG + Intronic
962272075 3:133984654-133984676 GGGCTTGTGTTTTATCTGCACGG - Intronic
962360238 3:134735371-134735393 ACACATGTATTTTCTCTGTAAGG + Intronic
963071180 3:141306653-141306675 GAGCCTGGATTTTATCTGGAAGG - Intergenic
963417101 3:145010708-145010730 CCACCTGTATTTTCTCTCTAAGG - Intergenic
964513233 3:157476674-157476696 GCTCATGTATTCTACCTGCAGGG - Intronic
965615677 3:170589841-170589863 GCAACTTTATTTACTCTGCATGG - Intronic
967143968 3:186590136-186590158 GTGCCTCTATTTTATCTCCAGGG - Intronic
968546423 4:1201148-1201170 GCACCTGCATTTGGCCTGCAGGG - Intronic
968605313 4:1532553-1532575 GCACCTGCATCGAATCTGCAGGG + Intergenic
971074961 4:23137456-23137478 GAACATGTATTTTCTCTGTAAGG - Intergenic
971093475 4:23371944-23371966 GCACCTGAACTTTACCTTCAAGG - Intergenic
973294915 4:48507833-48507855 GTTCCTGTTTATTATCTGCAGGG + Intronic
973642519 4:52917546-52917568 GCACCTGTCTTTGATCACCATGG - Intronic
974799991 4:66804536-66804558 GTCCTTGTATTTTATCTGCCTGG + Intergenic
975508851 4:75170321-75170343 TTACCTGTATTTTATTCGCAAGG + Intergenic
975838609 4:78450973-78450995 ACACTTGTTTTTTATCCGCAGGG - Intronic
977786190 4:101037339-101037361 AGACTTGTATTTTATCTGCAAGG + Intronic
979517688 4:121629899-121629921 GCTCTTGTATTTTATGTTCAAGG - Intergenic
981208858 4:142077071-142077093 GCGCCTGTAATTTATCTGTTGGG - Intronic
983774007 4:171583833-171583855 CTCCCTGTATTTTATTTGCAGGG + Intergenic
984115680 4:175678008-175678030 GCACATGTATTTTATATATATGG + Intronic
984312585 4:178081909-178081931 ATACCTGTATTTTCTCTGTAAGG + Intergenic
986066556 5:4240161-4240183 TCAGCTGTTTTTTATCTGCCAGG - Intergenic
989442087 5:41484814-41484836 GCACCTGAATGTTATTTCCAAGG - Intronic
990139419 5:52685689-52685711 GCACCTGTTTTTGCTCTGCAGGG - Intergenic
990684657 5:58287999-58288021 GCAAATGCATTTTAGCTGCAAGG - Intergenic
991487132 5:67149055-67149077 GCACCAGAATTATCTCTGCAAGG + Intronic
994125542 5:96166158-96166180 TCACATCTGTTTTATCTGCAGGG - Intergenic
995245757 5:109933466-109933488 ACACGTGTAATGTATCTGCAAGG + Intergenic
996542339 5:124643682-124643704 GCATTTGTTGTTTATCTGCAGGG - Exonic
997168131 5:131684020-131684042 ACACATGTATTTTTTCTGTAAGG + Intronic
998371230 5:141662833-141662855 ACACATGTATTTTCTCTGTAAGG - Intronic
998480088 5:142455662-142455684 ACACATGTATTTTCTTTGCAAGG - Intergenic
999441268 5:151602577-151602599 GCACCTGTATTTCACCTGTCTGG - Intergenic
1004529943 6:16444653-16444675 GCATCTGTAATTTATCTACCCGG - Intronic
1006697464 6:35943362-35943384 GCATTTGTATTTTATATGCAAGG - Intergenic
1007581325 6:42961894-42961916 GCACACGTATTTTAACTTCAAGG + Intronic
1011671009 6:89683061-89683083 GGATCTGTGTTTTATGTGCAAGG - Intronic
1012121381 6:95371519-95371541 GGAGCTGTATTTTAACTGGAAGG + Intergenic
1012362645 6:98402737-98402759 CCCCTTGTATTTCATCTGCAGGG - Intergenic
1016011315 6:139139899-139139921 ACACCTGTGTTTTATGTGAATGG - Intronic
1016710026 6:147159688-147159710 GCACCAGCATTTTCTCTGCTTGG - Intergenic
1018303517 6:162429259-162429281 GCACGTGGCTTTTATCTTCATGG + Intronic
1021293311 7:18872727-18872749 GCACCTATATTTAATATCCATGG + Intronic
1024334441 7:48191763-48191785 ACACCTGTGTTTTGTCTTCATGG + Intronic
1026472621 7:70707215-70707237 GCATCTGCATTTTATAGGCAGGG + Intronic
1028882893 7:95899983-95900005 TCGCCTGTATTTTGTATGCAAGG + Intronic
1031192227 7:118567642-118567664 GCTCCTGTCCATTATCTGCATGG + Intergenic
1034550532 7:151817637-151817659 GCACCTGTAGGTTATCACCAGGG + Intronic
1037785282 8:21899349-21899371 GCAGCTCTATTTTGTCTGCTGGG + Intergenic
1040664386 8:49615420-49615442 GTACCTGGATTCAATCTGCAAGG - Intergenic
1041466416 8:58162028-58162050 GGATATCTATTTTATCTGCAAGG - Intronic
1044990565 8:97791772-97791794 GCACCTGTATTTTATGAACATGG + Intronic
1045950865 8:107850286-107850308 GGCACTGTATTTTATCTCCATGG - Intergenic
1047242372 8:123102923-123102945 ACACATGTATTTTCTCTGTAAGG - Intronic
1047743190 8:127823727-127823749 ACTCCTGTGCTTTATCTGCAAGG + Intergenic
1048591043 8:135821056-135821078 GTAACTTTATTTTATCTACAGGG + Intergenic
1048944624 8:139432992-139433014 CCACCTCTATTTTATAAGCAGGG + Intergenic
1049398511 8:142413005-142413027 GCACCTGAATTCTTTCTTCATGG - Intergenic
1050677702 9:8075077-8075099 CCAACAGTATTTTATCAGCAGGG + Intergenic
1052287325 9:26801088-26801110 GCACCTGCATTTAATATACATGG - Intergenic
1053317049 9:37060748-37060770 TTACCTCTATTTTATCTGTATGG - Intergenic
1056922383 9:90802021-90802043 CCACCTGTATTTTATTCACATGG - Intronic
1056928494 9:90854770-90854792 GCACCTGAATTTCAGCTGCAGGG - Intronic
1058300487 9:103365502-103365524 GCATGTGTATTTTATGTGTATGG - Intergenic
1058984690 9:110199755-110199777 CCACCTTTCTTTTCTCTGCATGG - Exonic
1060117464 9:120953738-120953760 GAAATTGTATTTTATCTGGAGGG + Exonic
1061061348 9:128251880-128251902 GCATCTGTTTTGTTTCTGCATGG + Intronic
1187040744 X:15593107-15593129 TCACCTTCACTTTATCTGCAGGG - Intronic
1188510676 X:30933292-30933314 GCAGCTTCATTTTATTTGCATGG + Intronic
1192728674 X:73779788-73779810 ACACGTGTATTTTATCCTCACGG + Intergenic
1192782607 X:74309310-74309332 GTACATGTATTTTATCTTCTTGG - Intergenic
1198486255 X:137090385-137090407 GCTCATGTATTTTATTTGGAAGG + Intergenic
1199204704 X:145135265-145135287 GCATCTGTATTTTATTTTCTAGG - Intergenic