ID: 1125390118

View in Genome Browser
Species Human (GRCh38)
Location 15:39183730-39183752
Sequence GAAGGGGTTAAGAGCAGCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125390118_1125390126 13 Left 1125390118 15:39183730-39183752 CCAGAGCTGCTCTTAACCCCTTC No data
Right 1125390126 15:39183766-39183788 GAGACTCAAGGAAGTCATGGAGG No data
1125390118_1125390125 10 Left 1125390118 15:39183730-39183752 CCAGAGCTGCTCTTAACCCCTTC No data
Right 1125390125 15:39183763-39183785 TGTGAGACTCAAGGAAGTCATGG No data
1125390118_1125390128 27 Left 1125390118 15:39183730-39183752 CCAGAGCTGCTCTTAACCCCTTC No data
Right 1125390128 15:39183780-39183802 TCATGGAGGTGAAAGCCACTGGG No data
1125390118_1125390124 1 Left 1125390118 15:39183730-39183752 CCAGAGCTGCTCTTAACCCCTTC No data
Right 1125390124 15:39183754-39183776 TGGGATTAGTGTGAGACTCAAGG No data
1125390118_1125390127 26 Left 1125390118 15:39183730-39183752 CCAGAGCTGCTCTTAACCCCTTC No data
Right 1125390127 15:39183779-39183801 GTCATGGAGGTGAAAGCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125390118 Original CRISPR GAAGGGGTTAAGAGCAGCTC TGG (reversed) Intergenic
No off target data available for this crispr