ID: 1125397695

View in Genome Browser
Species Human (GRCh38)
Location 15:39268325-39268347
Sequence ATGTTCCCCTTCCTGTGTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 987
Summary {0: 187, 1: 148, 2: 158, 3: 153, 4: 341}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125397695_1125397706 12 Left 1125397695 15:39268325-39268347 CCTGGACACAGGAAGGGGAACAT 0: 187
1: 148
2: 158
3: 153
4: 341
Right 1125397706 15:39268360-39268382 CCTGTCACTGGGTGAGGGGAAGG No data
1125397695_1125397708 14 Left 1125397695 15:39268325-39268347 CCTGGACACAGGAAGGGGAACAT 0: 187
1: 148
2: 158
3: 153
4: 341
Right 1125397708 15:39268362-39268384 TGTCACTGGGTGAGGGGAAGGGG No data
1125397695_1125397703 7 Left 1125397695 15:39268325-39268347 CCTGGACACAGGAAGGGGAACAT 0: 187
1: 148
2: 158
3: 153
4: 341
Right 1125397703 15:39268355-39268377 CGGGGCCTGTCACTGGGTGAGGG No data
1125397695_1125397704 8 Left 1125397695 15:39268325-39268347 CCTGGACACAGGAAGGGGAACAT 0: 187
1: 148
2: 158
3: 153
4: 341
Right 1125397704 15:39268356-39268378 GGGGCCTGTCACTGGGTGAGGGG No data
1125397695_1125397712 30 Left 1125397695 15:39268325-39268347 CCTGGACACAGGAAGGGGAACAT 0: 187
1: 148
2: 158
3: 153
4: 341
Right 1125397712 15:39268378-39268400 GAAGGGGGAGGGATAGCATTAGG 0: 521
1: 11216
2: 12439
3: 9718
4: 7231
1125397695_1125397702 6 Left 1125397695 15:39268325-39268347 CCTGGACACAGGAAGGGGAACAT 0: 187
1: 148
2: 158
3: 153
4: 341
Right 1125397702 15:39268354-39268376 CCGGGGCCTGTCACTGGGTGAGG No data
1125397695_1125397709 15 Left 1125397695 15:39268325-39268347 CCTGGACACAGGAAGGGGAACAT 0: 187
1: 148
2: 158
3: 153
4: 341
Right 1125397709 15:39268363-39268385 GTCACTGGGTGAGGGGAAGGGGG No data
1125397695_1125397699 0 Left 1125397695 15:39268325-39268347 CCTGGACACAGGAAGGGGAACAT 0: 187
1: 148
2: 158
3: 153
4: 341
Right 1125397699 15:39268348-39268370 GACACACCGGGGCCTGTCACTGG No data
1125397695_1125397700 1 Left 1125397695 15:39268325-39268347 CCTGGACACAGGAAGGGGAACAT 0: 187
1: 148
2: 158
3: 153
4: 341
Right 1125397700 15:39268349-39268371 ACACACCGGGGCCTGTCACTGGG No data
1125397695_1125397711 19 Left 1125397695 15:39268325-39268347 CCTGGACACAGGAAGGGGAACAT 0: 187
1: 148
2: 158
3: 153
4: 341
Right 1125397711 15:39268367-39268389 CTGGGTGAGGGGAAGGGGGAGGG No data
1125397695_1125397710 18 Left 1125397695 15:39268325-39268347 CCTGGACACAGGAAGGGGAACAT 0: 187
1: 148
2: 158
3: 153
4: 341
Right 1125397710 15:39268366-39268388 ACTGGGTGAGGGGAAGGGGGAGG No data
1125397695_1125397707 13 Left 1125397695 15:39268325-39268347 CCTGGACACAGGAAGGGGAACAT 0: 187
1: 148
2: 158
3: 153
4: 341
Right 1125397707 15:39268361-39268383 CTGTCACTGGGTGAGGGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125397695 Original CRISPR ATGTTCCCCTTCCTGTGTCC AGG (reversed) Intergenic
900700388 1:4045022-4045044 CTGTTCCCCTTCCTGTGTCCAGG - Intergenic
901238424 1:7679732-7679754 CTGTTCCCCTAGCTGTGCCCTGG - Intronic
901262967 1:7887077-7887099 ATCTGGCCCTTCCTGTGGCCAGG + Intergenic
901575993 1:10201354-10201376 ATGTCCCTCTTCTTGTGTTCTGG + Intergenic
901717345 1:11167053-11167075 ATGTTCCCCATCCTGTGTCCAGG - Intronic
901943552 1:12682858-12682880 ATGTTCCCCTTCCTGTGTCCAGG - Intergenic
902754173 1:18538127-18538149 ATTTCCCTCTTCCTGTTTCCAGG + Intergenic
904947250 1:34208431-34208453 ATGGAGCCCTTCCTGTGTGCTGG + Intronic
905700316 1:40008040-40008062 ATGTTCCCCTTCCTGTGTCCAGG - Intergenic
905757922 1:40527458-40527480 ATGTTCCCCACCCTGTGTCTAGG - Intergenic
906355382 1:45101848-45101870 ATGTTCCCCGCCCTGTGTACAGG - Intronic
906451170 1:45949152-45949174 ATCTGCCCATTCCTGTGTCCAGG - Intronic
906581688 1:46940451-46940473 GTCATCCCCTTCCTGTGCCCCGG - Intronic
906602027 1:47138447-47138469 GTCATCCCCTTCCTGTGCCCCGG + Intronic
906674153 1:47681181-47681203 CTGTTCACCTTCCTGTCTCCAGG + Intergenic
907016788 1:51023262-51023284 ATGTTCCCTGCCCTGTGTCCAGG + Intergenic
907271564 1:53294356-53294378 ATTTCCCACTTCCTTTGTCCTGG - Intronic
907591798 1:55681006-55681028 ATGTTCCCTGCCCTGTGTCCAGG + Intergenic
907645914 1:56243185-56243207 ATGTTCCCCTTCCTGTGTCCAGG + Intergenic
908247527 1:62239697-62239719 ATGTTCCCTGCCCTGTGTCCAGG + Intronic
909414349 1:75388019-75388041 ATATTCCCCTTCCTGTGTCCAGG - Intronic
909449622 1:75784235-75784257 ATGTTCCCTGCCCTGTGTCCAGG - Intronic
909596254 1:77409808-77409830 CTTTGCCCATTCCTGTGTCCAGG + Intronic
909654924 1:78021165-78021187 ATGTTCCCCTTCCTGTGTCCAGG + Intronic
909861376 1:80609939-80609961 ATCTTCCCCTCCCTGTGTCCAGG + Intergenic
910433087 1:87178011-87178033 ATGATCCATTTCCAGTGTCCTGG + Intergenic
910481986 1:87668969-87668991 ATGTTCCCCATCCTGTGTCGAGG - Intergenic
910580580 1:88819961-88819983 ATGTTCCCCTCCCTGTGTCCAGG - Intronic
911139579 1:94484594-94484616 GTGTTCCCCACCCTGGGTCCAGG - Intronic
911186294 1:94908325-94908347 ATGTTCCTGTGCCTGGGTCCAGG + Intronic
911516652 1:98875813-98875835 ATGTTCCCTGCCCTGGGTCCAGG + Intergenic
911824011 1:102457790-102457812 ATGTTCCCCTTCCTGTGTCCAGG - Intergenic
912253898 1:108039668-108039690 ATGTTCCCCTTCCTGTGTCCAGG + Intergenic
913525763 1:119691278-119691300 ATGTTCCCCACCCTGTGTCCAGG + Intronic
914414216 1:147463825-147463847 ATTTGCCCATTCCTATGTCCAGG + Intergenic
914797044 1:150928777-150928799 ACGTTCCCCATCCTGTGTCCAGG + Intronic
915089388 1:153412942-153412964 ATGTTCCCCTTCTTGTGTCCAGG - Intergenic
915711967 1:157908462-157908484 ATGTTCTCTGCCCTGTGTCCAGG - Intergenic
916252399 1:162751954-162751976 ATGTTCTCCGCCCTGTGTCCAGG - Intronic
916381981 1:164221983-164222005 ATGTTCCCCTTCCTGTGTCCAGG - Intergenic
916492277 1:165312540-165312562 AGGTTCCACTTCCTGTCTCTTGG + Intronic
916598526 1:166270254-166270276 ATGTTCCCCTTCCTGTGTCTAGG - Intergenic
917471088 1:175326527-175326549 GTCTTCCCCTTCCAGTCTCCAGG + Intronic
917741947 1:177969465-177969487 ATGTGCCCTTCCCTGTGTCTGGG - Intronic
917884949 1:179374783-179374805 ATGTTCCCCACCCTGTGTCCAGG - Intronic
918759990 1:188391923-188391945 TTGTTTCCCTCTCTGTGTCCAGG - Intergenic
918816392 1:189190938-189190960 ATGTTCCGCTTTCTGTGTCCAGG + Intergenic
919002658 1:191853427-191853449 ATGTTTCCCGCCCTGTGTCCAGG + Intergenic
919240380 1:194907624-194907646 ATATTCCCCTTCCTGTGTCCAGG - Intergenic
919262987 1:195221932-195221954 ATGTTCCCCACCGTGTGTCCAGG - Intergenic
920008345 1:202849881-202849903 ATGTTCACCTTCCTGTGGCCTGG + Intergenic
920939253 1:210465656-210465678 CTCTTCCCCTACCTGTGTCTTGG - Intronic
921390713 1:214610751-214610773 ATTTGCCCATTCCTGTGTCCGGG + Intronic
921439879 1:215173152-215173174 ATGTTCCCCTTCCTGTGTCCAGG + Intronic
921841032 1:219828751-219828773 CTTTGCCCATTCCTGTGTCCAGG + Intronic
922440185 1:225649048-225649070 ATGTTACTCCTCCTGTTTCCAGG - Intronic
922622399 1:226999907-226999929 ATATTCCCCTCCCTGTGTCTGGG - Intronic
922724366 1:227915559-227915581 GTGTTGCCCTTCCTGTGTCATGG - Intergenic
923326126 1:232881805-232881827 AAGTTTCCCTTCCTGTTTCTTGG + Intergenic
923451468 1:234121746-234121768 ATGTTCCCTGCCCTGTGTCCAGG + Intronic
923524524 1:234762161-234762183 ATGTTCCCCACCCTGTGTCCAGG + Intergenic
924128895 1:240884827-240884849 CTTTGCCCGTTCCTGTGTCCAGG - Intronic
924130994 1:240908156-240908178 ATGTTCCTCGCCCTGTGTCCAGG - Intronic
924193370 1:241579133-241579155 ATTTTCTCCTTCCTGAGTGCAGG + Intronic
924255106 1:242174857-242174879 ACGTTCCCCTTCCTATGTCCAGG - Intronic
924911078 1:248513885-248513907 ATGTCCCCCTTCCTGTGTCCAGG + Intergenic
924913023 1:248534155-248534177 ATGTCCCCCTTCCTGTGTCCAGG - Intergenic
1063175383 10:3546135-3546157 ATGTTCCCCTTCCTGTGTCCAGG + Intergenic
1063276866 10:4578805-4578827 AGGTCCCCTTTCCTGTGTCCAGG - Intergenic
1063507771 10:6617037-6617059 ATGTTCCCCTTCCTGTGTCCAGG + Intergenic
1064072366 10:12241877-12241899 CTGATTCCCTTCCTGTGGCCAGG + Intronic
1064454948 10:15478618-15478640 TTGTTCCCCTCACTGTTTCCTGG + Intergenic
1064510359 10:16083193-16083215 ATGTTCCCCTTCCTGTGTCCAGG + Intergenic
1066182652 10:32978475-32978497 ATGTTTCCCGCCCTGTGTCCAGG + Intronic
1066696413 10:38082759-38082781 ATGTTCCCCTTCCTGTGTCCAGG - Intergenic
1066813068 10:39367310-39367332 ATGTTCCCATTCCTGTGTCCAGG + Intergenic
1067198662 10:44146286-44146308 ATGTTCCCCTTCCTGTGTCCAGG + Intergenic
1067207182 10:44228879-44228901 ATGTTCCCCTCCTTGAGTCCAGG - Intergenic
1068125862 10:52841090-52841112 ATGTTCCCCACCCTGTGTCCAGG + Intergenic
1068245917 10:54367614-54367636 ATGTTTTCCTCCCTGTGTCCAGG - Intronic
1069141699 10:64835560-64835582 ACGTTCCCCTTCCTGTATCCAGG + Intergenic
1069162124 10:65105688-65105710 ATGTTCCCCTTCCTGTGTCCAGG - Intergenic
1069193854 10:65524440-65524462 ATGTTCCCCTTCCTGTGTCCAGG - Intergenic
1069194200 10:65528170-65528192 ATGTTCCCCTTCCTGTGTCCAGG - Intergenic
1069260454 10:66387903-66387925 ATGTTCCCCACCCTGTGTCCAGG - Intronic
1070062287 10:72995829-72995851 ATGTTCCCCATCCTGTGTCCAGG - Intergenic
1071207423 10:83297399-83297421 ATGTTCCCCTTCCTGTGTCCAGG - Intergenic
1071453557 10:85822996-85823018 ATGTTCCCCTTCCTGTGTCCAGG - Intronic
1071984543 10:91037246-91037268 ATGTTCCCCTTCTTCCATCCAGG + Intergenic
1072119820 10:92396515-92396537 AGGTTTCCCTTCCTGGGTGCTGG - Intergenic
1072368613 10:94741198-94741220 GTTTTTCCCTTCATGTGTCCAGG + Intronic
1072491050 10:95906422-95906444 ATGTTCCCCTTCCTGTGTCCAGG - Intronic
1073948066 10:108775422-108775444 TTGTTCCCCTCCCTGTGTCCAGG + Intergenic
1074001046 10:109373206-109373228 ATGTTCCCCACCTTGTGTCCAGG - Intergenic
1074125891 10:110528562-110528584 ATCCTCCCCGTCCTGTTTCCTGG - Intergenic
1074680286 10:115899139-115899161 ATGTTCCCATTCCTGTGTCCAGG + Intronic
1074811378 10:117108515-117108537 ATGTTCCCCTTCCTGTGTCCAGG - Intronic
1075010262 10:118862548-118862570 ATGTTTCCCGCCCTGTATCCAGG + Intergenic
1075342618 10:121659686-121659708 TGGTTCTCCTTCCTGTGGCCAGG - Intergenic
1075858588 10:125653445-125653467 ATGGTCCCCACCCTGTGTCCAGG - Intronic
1076177487 10:128379344-128379366 ATTTTCCCCTAACTGTGTGCAGG + Intergenic
1076601840 10:131662296-131662318 ATGTTCCCCTTCCCGTGTCCAGG - Intergenic
1076829989 10:132989216-132989238 CTGTTCCCCTCTCTGTGCCCTGG + Intergenic
1077156327 11:1093372-1093394 ATGTTCCCCTGCGTTTGTTCTGG + Intergenic
1077290768 11:1790606-1790628 TTTTTCCCCTTCATATGTCCAGG + Intergenic
1077348715 11:2078700-2078722 ATGTTCCCCTTCCTGTGTCCAGG + Intergenic
1077500247 11:2906673-2906695 ATATTCCCCGCCCTGTGTCCAGG - Intronic
1077636837 11:3847598-3847620 AAGTTCTCCTTCCTCAGTCCTGG + Intergenic
1077861207 11:6181759-6181781 ATGTTCCCCTTCCTGTGTCCAGG - Intergenic
1078027456 11:7710788-7710810 ATGTTCCCCTTCCTGTGTCCAGG - Intergenic
1078242263 11:9540517-9540539 ATGTTCCCCTTCCTGTGTCCAGG + Intergenic
1078382877 11:10859826-10859848 ATGTTCCCCACCCTGTGTCCAGG + Intergenic
1078681974 11:13485848-13485870 ATATTCCCCACCCTGTGTCCAGG - Intergenic
1078825344 11:14924604-14924626 GTGTTTCCATTCCTGTATCCAGG + Intronic
1079409682 11:20175424-20175446 ATTTTTCCCTTCCTTTGTTCTGG - Intergenic
1079552404 11:21715892-21715914 AAGTTCCCCTTCCTGTGTCCAGG + Intergenic
1079995547 11:27291678-27291700 ATGTTCCAGGTACTGTGTCCAGG - Intergenic
1080500672 11:32867895-32867917 CTTTTCCCATTCCTATGTCCAGG - Intergenic
1080700071 11:34637241-34637263 CTGCTCCCCTTCATGGGTCCAGG + Intronic
1080742111 11:35075944-35075966 ATATTCTCCTTCCTGTGTCCAGG + Intergenic
1080747843 11:35125099-35125121 TTGTTCCCCTCCCTGTGTCTAGG - Intergenic
1081160389 11:39741823-39741845 ATGTTTGTCTTCCTGTGTCTGGG - Intergenic
1081468375 11:43346281-43346303 GTATTCCCCTTCATGTGTCCAGG + Intergenic
1082682935 11:56200968-56200990 ATGTTCCCCTTCCTGTGTCCAGG + Intergenic
1083495585 11:63049591-63049613 ATTTGCCGGTTCCTGTGTCCCGG + Intergenic
1085009092 11:73124218-73124240 ATGTTCCCCATCCTGTGTCCAGG - Intronic
1085205022 11:74726501-74726523 GCGTCCCCCTTCCTCTGTCCAGG - Intronic
1085956873 11:81408902-81408924 ATGTTCCCCTCCCTGTGTCCAGG - Intergenic
1086050326 11:82581610-82581632 ATGTTCCCCTCCCTGTGTCCCGG - Intergenic
1086388869 11:86339933-86339955 ATGTTCCCTGCCCTGTATCCAGG + Intronic
1087083007 11:94189840-94189862 ATGTTCCCCTTCCTGTGTCCAGG + Intergenic
1087794124 11:102437841-102437863 ATGTTCCTCATCCTGTTTCAGGG + Intronic
1087880976 11:103416108-103416130 ATGGTTCCCTTCCTGTGTCCAGG - Intronic
1087916260 11:103814994-103815016 ATGTTCCCCTTCCTGTGTCCAGG + Intergenic
1087956849 11:104299157-104299179 ATGTTCCCCTCCTTGTGTCCAGG + Intergenic
1088370624 11:109084574-109084596 ATGTCCCCCACCCTGTGTCCAGG + Intergenic
1088983438 11:114884615-114884637 ATGTTCCCCTTCCTGCGTCCAGG + Intergenic
1090349091 11:126095809-126095831 ATGTTCCCCTGCCTGTGCCTAGG + Intergenic
1090359374 11:126161819-126161841 GTGTTCCCCATCCGGTGTCCAGG + Intergenic
1090515047 11:127416060-127416082 ATGTTCCCCACCCTGTGTCCAGG + Intergenic
1090598209 11:128342291-128342313 GTGTTGCCCTTCCGGTGGCCTGG - Intergenic
1091867811 12:3857085-3857107 ATGTTCCCTGCCCTGTGTCCAGG - Intronic
1092019089 12:5185563-5185585 ACGTTCCCCTTCAAGTGCCCTGG + Intergenic
1092171123 12:6374710-6374732 TTGTTCCCCTTCATGAGCCCTGG + Exonic
1092171150 12:6374830-6374852 TTGTTCCCCTTCATGAGCCCCGG + Exonic
1092579723 12:9825585-9825607 ATTTGCCCATTCCTGTGTCCAGG - Intergenic
1092594769 12:9989171-9989193 ATGTTCCCCTTCCTGTGTCCAGG - Intronic
1092856126 12:12675305-12675327 CTCTTCCCCTTCCTAGGTCCTGG - Intronic
1093809928 12:23479572-23479594 ATGTTCACCTTTCTGTGCCTGGG - Intergenic
1094037189 12:26084025-26084047 ATGTTCCTCACCCTGTGTCCAGG - Intergenic
1094101400 12:26768222-26768244 ATATTCCCCTTCCTGTGTCCTGG - Intronic
1094248386 12:28329798-28329820 ATGTTCCCCGCCCTGTGTCCAGG + Intronic
1094304409 12:29001426-29001448 TTGTTCCCCTCCCTGTGTCCTGG - Intergenic
1094345700 12:29466055-29466077 ATCTTCCCCTTCCTGTGTCTAGG - Intronic
1094804622 12:34076954-34076976 ATGTTCCCCTTGCTGTGTCCGGG - Intergenic
1095293289 12:40500887-40500909 CTGTTCTCCTCCCTGTGTCTTGG - Intronic
1095333650 12:41000816-41000838 TTGTTCCCTTTTATGTGTCCAGG + Intronic
1095576959 12:43751380-43751402 ACGTTCCCCTTCCGGTGTCCAGG + Intronic
1095677825 12:44939927-44939949 ATGTTCCCCTTCCTGTGTCCAGG - Intergenic
1095713607 12:45317304-45317326 ATGTTCCCCTTCCTGTGTCCAGG + Intronic
1095804798 12:46307224-46307246 ATGTTCCCCTTCCTGTGTCCAGG + Intergenic
1095817895 12:46444482-46444504 ATGTTCCTATTCATGTTTCCAGG - Intergenic
1095826963 12:46540112-46540134 ATGTTCCCCGTCCTGTGTCCAGG + Intergenic
1095845800 12:46742937-46742959 ATGTTCTCCGTCCTGTGTCCAGG - Intergenic
1095935787 12:47679206-47679228 ATGTTCCCTGCCCTGTGTCCAGG - Intronic
1096205037 12:49714324-49714346 ATGTTCCCCTCCCTGTGTCCAGG - Intronic
1096844320 12:54397242-54397264 ATGTGCCCCCACCTCTGTCCTGG - Intronic
1096893879 12:54800283-54800305 ATGTTCCCCACCCTGTGTCCAGG - Intergenic
1096934033 12:55249938-55249960 ATGTTCGCCTTCCTGTGTCCAGG + Intergenic
1097326394 12:58282043-58282065 ATGTTCCCCTTCCTGTGTCCAGG + Intergenic
1097878664 12:64667616-64667638 CTCTTTCCCTGCCTGTGTCCTGG + Intronic
1098236281 12:68421503-68421525 ATGTTCCCCTCGCTGTGTCCAGG - Intergenic
1098436685 12:70475673-70475695 ATGTTTCCCTTTCTGTGTCCAGG - Intergenic
1098723325 12:73929512-73929534 ATGTTCCCCTTCCTGTTTCCAGG - Intergenic
1098878957 12:75896971-75896993 TTGTTCCCCTCCCTGTGTCCAGG - Intergenic
1099426758 12:82532973-82532995 ACATGCCCCTTCCTGTGTCCAGG - Intergenic
1099427741 12:82545365-82545387 ATGTTCCCCTTCCTGTGTCCAGG + Intergenic
1099625259 12:85064588-85064610 ATTTGCCCAGTCCTGTGTCCTGG + Intronic
1099742986 12:86665456-86665478 AAGTTCCGCTTCCTGGGTTCAGG + Intronic
1100306254 12:93352588-93352610 GTGTTCTCGTTCCTGCGTCCAGG - Intergenic
1100815504 12:98383498-98383520 TTTTTCCCCTCCCTGTGTCCAGG - Intergenic
1100905460 12:99293309-99293331 ATGTTCCCCACCCTGTGTCCAGG - Intronic
1101057438 12:100933302-100933324 ATGTTCCCCGTCCTGTGTCCAGG + Intronic
1101459707 12:104878495-104878517 ATGTTCTCCACCCTGTCTCCAGG + Intronic
1101780436 12:107829928-107829950 ATGTTCCCCACCCTGTGTCCAGG + Intergenic
1102448951 12:113026223-113026245 ATGTTTCCATTCCTGTCTTCTGG - Intergenic
1102622686 12:114209293-114209315 ATGTCCCCTGCCCTGTGTCCAGG - Intergenic
1102755899 12:115340114-115340136 ATGTTCCCTTCCCTGTGTCCAGG + Intergenic
1103193448 12:119021988-119022010 TTGTTCCCCTCCCTGTGTCAAGG - Intronic
1103195857 12:119043347-119043369 CTGTTCCCCTCCCTGTGTCCAGG - Intronic
1103248285 12:119477193-119477215 AACCTCTCCTTCCTGTGTCCTGG - Intronic
1104073474 12:125369054-125369076 ATGTTCCCCACCCTGTGTCCAGG + Intronic
1104718344 12:131031052-131031074 GTGTTGCCCTTCCTGCGTTCCGG - Intronic
1105645459 13:22313075-22313097 ATGGTCCCCTCCCTGTGTCTAGG + Intergenic
1106559594 13:30836940-30836962 ATGTTCCTTTTTCTCTGTCCAGG + Intergenic
1106611770 13:31290050-31290072 ATGTTCCCCTCCCTGTGTCCAGG + Intronic
1106649906 13:31679105-31679127 ATGTTCCCCACCCTGTGTCCAGG + Intergenic
1107239482 13:38214736-38214758 ATGTTCCCCTTCCTGTGTCCAGG - Intergenic
1108309738 13:49176440-49176462 ATGTTCCCCTCCCTGTGTCCAGG - Intronic
1108476667 13:50826042-50826064 ATGTTCCCCACCCGGTGTCCAGG + Intronic
1108794081 13:54009659-54009681 ATGTTCCCCTTCCTGTGTCCAGG - Intergenic
1109279619 13:60340961-60340983 ATGTTCCCCACCCTGTGTCCAGG + Intergenic
1109316663 13:60757287-60757309 ATATTCCCCTTCCTCTTTCCTGG + Intergenic
1109359090 13:61272378-61272400 ATGTTCCCCACCCTGTGTCCAGG - Intergenic
1109670485 13:65600438-65600460 ATGTTCCCCTTCCTGTGACCAGG - Intergenic
1109676676 13:65685314-65685336 ATGTTCTCCTTCCTGTGTCCAGG + Intergenic
1109683449 13:65783663-65783685 ATGTTCCCCTTGTTGAGACCCGG - Intergenic
1109737881 13:66510543-66510565 ATGTCCCCCTTCCTGTGTCCAGG + Intronic
1110010057 13:70321074-70321096 ATGTTCCCCTTCCTGTTGTGGGG - Intergenic
1110071810 13:71187085-71187107 ATGTTCCCCGCCCTGTGTCCAGG - Intergenic
1110659877 13:78047818-78047840 ATGTTCCCCACCCTGTGTCCAGG + Intergenic
1110686433 13:78380653-78380675 ATGTTCCCCTCCCTGTGTCCAGG + Intergenic
1110851856 13:80255097-80255119 ATGTTCCCCACCCTGTGTCCAGG - Intergenic
1110912590 13:80982304-80982326 ATGTCCCCCTTCCTGTGTCCAGG + Intergenic
1111072532 13:83187641-83187663 AGGTTCCCCATGCTGTGTGCAGG + Intergenic
1111103369 13:83614210-83614232 ATATTCCCCTTCCTGTGTCCAGG + Intergenic
1111235949 13:85407884-85407906 ATGCTGCTCTTCCTGTGTACAGG - Intergenic
1111387419 13:87544936-87544958 ATGTTCCCCTTCCTGTGTCCAGG - Intergenic
1111414584 13:87922746-87922768 ATGTTCTCCCTTCTCTGTCCTGG + Intergenic
1111424228 13:88058310-88058332 ATGTTCCCCTTCCTGTGTCCAGG + Intergenic
1111434754 13:88192093-88192115 ATGTTCTCCTTCCTGTGTCCAGG + Intergenic
1111640052 13:90957344-90957366 ATGTTCCCCTTCCTGTGTCCAGG - Intergenic
1111696133 13:91626852-91626874 ATGTTCCCCTTCCTGTGTCCAGG + Intronic
1112069355 13:95831086-95831108 GTGTTCCCCACCCTGTGTCCAGG - Intronic
1112094309 13:96115432-96115454 TTGTTCCCCACCCTGTGTCCAGG + Intronic
1112987258 13:105466420-105466442 ATGTTCCACTTCCTGTCTCCAGG - Intronic
1113005773 13:105700260-105700282 ATGTTCCCCTTCCTGTGTCCAGG + Intergenic
1113059734 13:106309400-106309422 ATGTTCCCCGCCCTGTGTCCAGG - Intergenic
1113400848 13:109991917-109991939 ATGTTCCCCTTCCTGTGTCCAGG - Intergenic
1114616840 14:24072889-24072911 GTGTTCCCTTTCCAGAGTCCAGG + Intronic
1114626068 14:24131265-24131287 ATGTTCCAGTTCCTGTGACAGGG - Exonic
1114694284 14:24612284-24612306 ATCTTCTCCTTCCTGGGTTCAGG + Intergenic
1114818199 14:25985140-25985162 ATGTTCCCTTCCCTGTGTCCAGG - Intergenic
1114886903 14:26864248-26864270 ATGTTCCCCTTCCTCTGTCCAGG + Intergenic
1115158764 14:30369363-30369385 ATATTCCCCTTCCTGTGTCCAGG - Intergenic
1115168836 14:30479858-30479880 ATGTTCCCCTTCCTGTGTCCAGG - Intergenic
1115235057 14:31201223-31201245 GTCTTCCCTTTCCTGTCTCCTGG - Intronic
1115259855 14:31440813-31440835 ATGTTCCCCATCCTGAGACATGG - Intronic
1115366090 14:32558794-32558816 ATTTTCCCCTTCTTGTGAGCTGG - Intronic
1115568646 14:34647005-34647027 ATGTGCCCCTTCCAGAGTTCAGG - Intergenic
1115728730 14:36245053-36245075 ATGTTCCACACCCTGTGTCCAGG - Intergenic
1115955066 14:38768643-38768665 ATGTTCCCCACCGTGTGTCCAGG - Intergenic
1116137499 14:40947598-40947620 ATGTTCCCCTGCCTGTGTCCAGG + Intergenic
1116618206 14:47165059-47165081 ATGTTCCCCTTCCTGTGTCCAGG - Intronic
1117241489 14:53838251-53838273 ATGTTCCCCGCCCTGTGTCCAGG - Intergenic
1117664805 14:58045420-58045442 ATGTCCCCCTTCCTGTGTCCAGG - Intronic
1117841496 14:59865026-59865048 ATGTAGCCCTTCCTATGTCTAGG - Intronic
1118583426 14:67327672-67327694 ATGTTCCCCACCCTGTGTCCTGG + Intronic
1118931081 14:70241319-70241341 ATGTTCCCCTCCCTGTGTCCAGG + Intergenic
1119144390 14:72297607-72297629 GTATTCCCCTTCATGTGTCCAGG + Intronic
1119498592 14:75103001-75103023 ATGTTCCCCTTCCTGTGTCCAGG - Intronic
1120059101 14:79960813-79960835 ATGTTCTCCTTTCTGTTTCATGG + Intergenic
1120349201 14:83330812-83330834 ATGTTCCCCTCCTTGTGTCCAGG + Intergenic
1120619394 14:86745210-86745232 ATGTTCCTCACCCTGTGACCAGG + Intergenic
1121218167 14:92264495-92264517 AGGTGCCCTTTCCTGTGCCCTGG + Intergenic
1121382337 14:93483722-93483744 ATGTTCCGCATCCTGGGTCCAGG + Intronic
1124160138 15:27260760-27260782 ATGTTGGCCTTCCTGTTTCCTGG - Intronic
1124414613 15:29464810-29464832 AAGTTCCCCGTCCTGCATCCAGG - Intronic
1124872617 15:33558279-33558301 ATGTTCCCCTTCCTGTGTCCAGG + Intronic
1125094481 15:35835211-35835233 ATTTTCCCCTTCCAGTTACCTGG + Intergenic
1125210231 15:37206332-37206354 ATGTTCCCCTTCCTGTGTCCAGG - Intergenic
1125397695 15:39268325-39268347 ATGTTCCCCTTCCTGTGTCCAGG - Intergenic
1125865246 15:43041401-43041423 ATGTTCCCCTTCTTGTGTCCAGG - Intronic
1126235241 15:46376193-46376215 ATGTTCCCCTTCCTGTGTCCAGG + Intergenic
1126775122 15:52093939-52093961 ATGTTAGCCATCCTGGGTCCTGG - Intergenic
1126783665 15:52159464-52159486 ATGTTCTCCTTCCCATGTCCAGG + Intronic
1126856399 15:52843707-52843729 ATGTTCCCCTTCCTGTGTCCAGG - Intergenic
1127047141 15:55038117-55038139 TTGTTCCCCTCTATGTGTCCAGG + Intergenic
1127139298 15:55957927-55957949 ATGTTCCCCACCCTGTGTCCAGG - Intronic
1128407215 15:67354907-67354929 ATTTTCCCCTTCATCTGGCCTGG - Intronic
1128526259 15:68414388-68414410 ATGTCCCCTTTGCTGAGTCCTGG - Intronic
1128676689 15:69615090-69615112 ATGTTGCTCTTGCTGTGCCCTGG - Intergenic
1128844141 15:70874471-70874493 ATGTTCCCCAACTTGTCTCCAGG - Intronic
1129132057 15:73508627-73508649 ATATTCCCCTTCCTGTGTCCAGG + Intronic
1129571284 15:76687623-76687645 ATGTTCCCCTTCTTGTGTCCAGG + Intronic
1129579024 15:76785834-76785856 ATGTTCCCCACCCTGTGTCCAGG - Intronic
1130333569 15:82940025-82940047 ATGTTCCCCACCCTGTCTCCAGG - Intronic
1131284536 15:91046096-91046118 ATGTTCCCCTTCCTGTGTCCAGG + Intergenic
1131774203 15:95776114-95776136 ATGTTCCCCTCCCTGTGTCCAGG - Intergenic
1132411727 15:101583898-101583920 ATCTTGCCCTCCCTGTGTCCAGG + Intergenic
1132607867 16:800980-801002 GGGTTCCCCCTCCAGTGTCCTGG + Intergenic
1133446537 16:5865877-5865899 ATGTGGCCTTTCCTGTGTGCAGG + Intergenic
1133961223 16:10495252-10495274 AGGTTGTTCTTCCTGTGTCCTGG - Intergenic
1134213297 16:12296133-12296155 ATTCTCCCCTTCCTGTGCTCTGG + Intronic
1134583662 16:15393359-15393381 ATGTTCCCCGCCCTGTGTCCAGG - Intergenic
1135997527 16:27262666-27262688 CTTTGCCCGTTCCTGTGTCCAGG - Intronic
1136237603 16:28924581-28924603 ATTTGCCCCTTCCTGGGACCGGG + Exonic
1136480744 16:30540030-30540052 AAGTTCACCTTTCTGTCTCCAGG - Intronic
1136986300 16:35108673-35108695 ATGTTCCCCTTCCTGCAAACAGG + Intergenic
1137456692 16:48623156-48623178 ATGTTCCTCTCCCTGTGTCCAGG + Intergenic
1137516954 16:49153645-49153667 ATGTTCCCCATTCTGTGTCCAGG - Intergenic
1137621375 16:49878557-49878579 GTGTTCCCCACCCTGTGTCCAGG + Intergenic
1137681412 16:50349204-50349226 ATGTTCCCCACCCTGTGTCCAGG - Intronic
1138555889 16:57771031-57771053 CCCTTCCCCTTCCTGTATCCAGG - Intronic
1138900314 16:61261267-61261289 ATGTTCCCCTCCTTGTGTCCAGG - Intergenic
1139010805 16:62631499-62631521 ATGTTCCCCACCCTGTGTCCAGG + Intergenic
1139151636 16:64388719-64388741 ATGTTCCCCTTCCTGTGTCCAGG + Intergenic
1139193979 16:64896970-64896992 ATATTCCCCTTCCTGTGCTCTGG - Intergenic
1139469231 16:67169575-67169597 ATGTTCCCCCTCCTTTCTTCAGG - Intronic
1140341127 16:74163605-74163627 AGTTTCCCCTTCCTGTGCCATGG - Intergenic
1140757629 16:78082474-78082496 ATGTTCCCCTCCCTGTGTCCAGG - Intergenic
1141276133 16:82589867-82589889 TTGTTCCCCTCTTTGTGTCCAGG + Intergenic
1141373677 16:83509940-83509962 ATGCTCCCAATCCTCTGTCCGGG - Intronic
1142414429 16:89933913-89933935 ACGTTCCCATGCCTGTGTCCTGG + Intronic
1142414441 16:89933954-89933976 ACGTTCCCATGTCTGTGTCCTGG + Intronic
1142414477 16:89934077-89934099 ACGTTCCCACGCCTGTGTCCTGG + Intronic
1142414490 16:89934118-89934140 ACGTTCCCACGCCTGTGTCCTGG + Intronic
1142414503 16:89934159-89934181 ACGTTCCCATGCCTGTGTCCTGG + Intronic
1142414516 16:89934200-89934222 ACGTTCCCATGCCTGTGTCCTGG + Intronic
1142414529 16:89934241-89934263 ACGTTCCCATGTCTGTGTCCTGG + Intronic
1143258182 17:5579069-5579091 ATGTTGCCCTTCCTGTGTCCAGG - Intronic
1143651609 17:8267012-8267034 TTGTTCCTCTTCCTAGGTCCGGG + Exonic
1143660951 17:8324378-8324400 ACGTGCCCCTTCAAGTGTCCTGG + Intergenic
1144307248 17:13979735-13979757 ATGTTCCCCAACCTGTGTCCAGG - Intergenic
1144355429 17:14441338-14441360 ATGTTCCCCACCCTGTGTCCAGG + Intergenic
1144456198 17:15420758-15420780 ATGTTCCCCTCCCTGTGTCCAGG + Intergenic
1144874187 17:18388627-18388649 AACTGCCCCTCCCTGTGTCCTGG + Intronic
1145158036 17:20555791-20555813 AACTGCCCCTCCCTGTGTCCTGG - Intergenic
1146448240 17:32950597-32950619 ATGTTCCCCTTCCTGTGTCCAGG + Intergenic
1146972346 17:37083223-37083245 GTGTTACCCTTCTTGTGCCCAGG + Intergenic
1147426551 17:40348513-40348535 ATGTCCCCACTTCTGTGTCCTGG + Intronic
1147793792 17:43028728-43028750 TTGTTCCCCTGCCTGCGCCCAGG + Exonic
1147864586 17:43544303-43544325 ATTCCCCCCTTCCTGTGTGCTGG - Intronic
1148457752 17:47820104-47820126 GTGCTCCCCTCCCTCTGTCCTGG - Intronic
1149520295 17:57313641-57313663 AAGTTCCCCTGCCTGTGCCAGGG - Intronic
1149539656 17:57459387-57459409 ATCTCTCCCTTCCTGTCTCCAGG - Intronic
1149595882 17:57864458-57864480 AGGTTCTCCTTCCTCTCTCCTGG - Intronic
1150283685 17:63943884-63943906 CAGTTCCCCTTCCTGCCTCCAGG + Intronic
1150865657 17:68846847-68846869 TTGTTCCCCTCCTTGTGTCAAGG - Intergenic
1151165735 17:72202050-72202072 ATGTTCCCCACCCTGTGTCCAGG + Intergenic
1151183220 17:72344619-72344641 ATGTTCCCCCTCCTTTCACCTGG - Intergenic
1152647196 17:81474891-81474913 ATGTCCACCTTCCTGAGTTCGGG - Intergenic
1153173718 18:2346404-2346426 ATGTTCCCCTTCCTGTGTCCAGG - Intergenic
1154180481 18:12134557-12134579 ATGTTCCCCTTCCTGTGTCCAGG + Intergenic
1154184132 18:12166906-12166928 ATGTTCCCTGCCCTGTGTCCAGG + Intergenic
1154343550 18:13523984-13524006 ATGGTCCCCCTCCTGTGTCCAGG - Intronic
1154416249 18:14177524-14177546 CTCTTTCCCTTCCTGTATCCAGG - Intergenic
1155131059 18:22934698-22934720 ACGTTCCCCTTCCTGTGTCCAGG + Intronic
1155185461 18:23383358-23383380 TTGGTTCCCTTCCTGTGTCTTGG - Intronic
1156002523 18:32401133-32401155 ATGTTCCCCTTGCTGTGTCCAGG - Intronic
1156079828 18:33319224-33319246 ATGTTCCCCTTCCTGTGTCCAGG + Intronic
1156563331 18:38154634-38154656 ATGTTCCCCTTCCTGTGTCCAGG + Intergenic
1156777728 18:40813642-40813664 ATGTTCCCCTCCCTGTGTCCAGG + Intergenic
1157219224 18:45813723-45813745 ATGTTCCCCTTCCTGTGTCCAGG - Intergenic
1158052384 18:53239002-53239024 ATGTCCCCCTTCCTGTGTCCAGG - Intronic
1158232841 18:55278240-55278262 GTGCTCCCCTTCCTGTGACATGG + Intronic
1158365040 18:56724836-56724858 ATGTTCCCCTTCCTGTGTCCAGG + Intronic
1158631432 18:59118457-59118479 ATGTTCCCCTTCCTGTGTCCAGG - Intergenic
1158762112 18:60402225-60402247 ACATTCCCCTTCCTGTGTCCAGG + Intergenic
1159059651 18:63501226-63501248 GTGTTCCCCTTCCTGTTTCCAGG + Intronic
1159146350 18:64458664-64458686 ATGTTCCCCTCCCTGTGTCCAGG - Intergenic
1159230108 18:65595892-65595914 CTTTTACCCTTCCTGTATCCTGG + Intergenic
1159256357 18:65952481-65952503 ATGTTCCCTTCCCTGCGTCCAGG - Intergenic
1159302832 18:66597850-66597872 ATGTTCCCCTTCTTGTGTCCAGG - Intronic
1159564786 18:70036501-70036523 TTGTTCCCCTCTTTGTGTCCCGG - Intronic
1159584497 18:70270827-70270849 ATGTTCCCACTCCTGACTCCAGG + Intergenic
1159872600 18:73775369-73775391 AGGGTCCCCTCCCTGGGTCCTGG + Intergenic
1160284845 18:77532324-77532346 CTGTTCCCCTTCCTGTGTCCAGG + Intergenic
1160448964 18:78949030-78949052 GATTTCCCCTTCCTGTCTCCAGG + Intergenic
1162521131 19:11180183-11180205 GGGTTCCCCTTCCTGTCCCCCGG + Intronic
1163063726 19:14777677-14777699 ATGTTTCCCGCCCTGTGTCCAGG + Intronic
1163380823 19:16967297-16967319 ATGTTCCCCGCCCTGTGTCCAGG - Intronic
1163869255 19:19804891-19804913 ATGTTCCCTGCCCTGTGTCCAGG - Intronic
1164133995 19:22394644-22394666 ATGTTCCCCGCCCTGTGTCCAGG - Intronic
1164164811 19:22662116-22662138 ATGTTCCCCGCCCTGTGTCCAGG + Intronic
1164333255 19:24281551-24281573 ATGTTCCCCTTCCTGTGTCCAGG + Intergenic
1164565608 19:29323844-29323866 ATGTCCCCATTCCTGCCTCCTGG + Intergenic
1166023593 19:40056207-40056229 CGGTTCCACTTCCTGTCTCCTGG - Exonic
1166126423 19:40717623-40717645 ATGAACCCCTGGCTGTGTCCAGG - Exonic
1166264154 19:41666821-41666843 ATGCTCTCCTTCATGTGTCCAGG + Intronic
1166913459 19:46177697-46177719 ATCCTCACCCTCCTGTGTCCAGG - Intergenic
1167096730 19:47378480-47378502 CTGTTCCGCTTCCTGCGGCCCGG - Intronic
1167228756 19:48268190-48268212 CTGTTCTACTTTCTGTGTCCAGG - Intronic
1167860455 19:52278942-52278964 CTTTGCCCATTCCTGTGTCCAGG + Intronic
1167862048 19:52292998-52293020 ATGTTACCCGCCTTGTGTCCAGG + Exonic
1168184860 19:54693685-54693707 ATGTTCCCCGCCCTGTGTCCAGG + Intronic
925082231 2:1079268-1079290 CTGTGCCCCTTCCTGTGCCCTGG - Intronic
925097135 2:1215737-1215759 ATGTTCCCCTTCCTGTGTCCAGG + Intronic
925756522 2:7138252-7138274 ATGTTCCCCTCCCTGTGTCCAGG - Intergenic
926271783 2:11372157-11372179 ATGTTCTTCCTCCTGTGGCCAGG + Intergenic
926447047 2:12955937-12955959 AAGTACCCCTTCCTATGTCAGGG + Intergenic
926778872 2:16448711-16448733 ATGTTCCCCTTCCTGCGTCCAGG + Intergenic
927248796 2:20980137-20980159 ATGTTCCCCTTCCTGTGTCCAGG - Intergenic
927653901 2:24929348-24929370 TTGTTCCCCTCTCAGTGTCCAGG + Intergenic
928118126 2:28562802-28562824 AGCTTCCTGTTCCTGTGTCCAGG + Intronic
928465906 2:31522215-31522237 TTCCTCCCTTTCCTGTGTCCAGG - Intergenic
929371252 2:41226320-41226342 TTGTTCCCCTCTCTGTGTCCAGG - Intergenic
929437702 2:41940838-41940860 AAGCTTCCCTTCCTGTCTCCAGG - Intronic
929799888 2:45090639-45090661 ATGTTTCCCTCCCTGTGTCCAGG + Intergenic
929934738 2:46286455-46286477 CTGTTTCCCTTCCTGGGGCCTGG + Intergenic
930421438 2:51157905-51157927 ATTTTACCCTTCCTATGCCCAGG - Intergenic
930505279 2:52275491-52275513 ATGTTCCCCATCCTGTGTCCAGG - Intergenic
930724407 2:54668329-54668351 CTGTGTCCCTTCCTCTGTCCAGG + Exonic
931520134 2:63087509-63087531 ATGTTCCCCTTTGTGAGTCCTGG - Intergenic
931734760 2:65183750-65183772 ATGTTCCCCTTCCTGTGTCCAGG - Intergenic
932123495 2:69122777-69122799 ATGTTCCCCTTCCTGTGTCCAGG + Intronic
932473164 2:71977753-71977775 ATGTTCCCCACCCTGTGTCCAGG + Intergenic
932506974 2:72243551-72243573 ATGTTCCCCACCCTGTGTCCAGG - Intronic
932830947 2:74989390-74989412 ATGTTCCCCGCCCTGTGTCCAGG - Intergenic
933068478 2:77829325-77829347 ATCTTTTCCTGCCTGTGTCCAGG - Intergenic
933550928 2:83774129-83774151 GTATTCCCCTTCATGTGTCCAGG - Intergenic
934984496 2:98874520-98874542 ATGCACCCCTCCCAGTGTCCAGG + Intronic
935003820 2:99049538-99049560 ATGTTCCCCTCCCTGTGTCCCGG - Intronic
935020815 2:99229363-99229385 ATGTTCCCCTTCCTGTGTCCAGG - Intronic
935431716 2:102983204-102983226 AGCTTCCTCTTCCTGTGTCTTGG + Intergenic
935740279 2:106141246-106141268 TTCTTCCACTTACTGTGTCCTGG - Intronic
936456582 2:112679572-112679594 AGCTTCCACTTCCTGTGTCTTGG + Intergenic
936784264 2:116074355-116074377 TTGTTCCCATCCCTGTGTCCAGG + Intergenic
937302345 2:120850992-120851014 ATAGTCCCCTCCCTGTGCCCTGG - Intronic
937397660 2:121552264-121552286 CTTTGCCCATTCCTGTGTCCAGG - Intronic
937744099 2:125390107-125390129 ATGTTCCCCGCCCTGTGTCCAGG + Intergenic
937805991 2:126146342-126146364 AGCTTCCCCATCCTGTGGCCCGG + Intergenic
938223982 2:129599469-129599491 TTGTTCCCCTCTCTGTGTCCAGG + Intergenic
938485522 2:131703240-131703262 ATGTTCCCCTTCCTGTGTCCAGG - Intergenic
938639686 2:133266198-133266220 CTGTCCCCCTTCAGGTGTCCTGG + Intronic
938686865 2:133746857-133746879 ATGTTCCCCTCCTTGTGTCCAGG + Intergenic
938780103 2:134576988-134577010 ATGTTCCGATTCCTCTGGCCTGG + Intronic
939093380 2:137804540-137804562 ATGTTCGCCACCCTGTGTCCAGG + Intergenic
940545769 2:155082678-155082700 ATGTTCCCCACCCTGTGTCCAGG - Intergenic
940573754 2:155472837-155472859 ATGTTCCCCACCCTGTGTCCAGG - Intergenic
940674470 2:156711984-156712006 CTTTTCCCATTCCTATGTCCAGG + Intergenic
940688304 2:156882121-156882143 ATATTCCCCTCCCTGTGTCCAGG + Intergenic
941240859 2:163035905-163035927 TTGTTCCCCTTTATGTGTTCAGG + Intergenic
941607052 2:167610962-167610984 CTGTTCCCCTCTTTGTGTCCAGG - Intergenic
941766931 2:169308405-169308427 ATGTTCCCCATCCTGTGTCCAGG + Intronic
941895279 2:170622755-170622777 ATGTTCCCCTTCCTGTGTCCTGG + Intronic
942015419 2:171808887-171808909 ATGCTCCCTGCCCTGTGTCCAGG + Intronic
942499887 2:176578329-176578351 ATGTTCCCCTTCCTGTGTTCAGG + Intergenic
942879744 2:180844866-180844888 CTCTTCCCCTTCCTATGTCCTGG - Intergenic
942917522 2:181329285-181329307 CTTTGCCCATTCCTGTGTCCAGG - Intergenic
943081513 2:183263476-183263498 ATGTTCCCCTTCCCGTGTCCAGG - Intergenic
943183337 2:184573515-184573537 ATGTTCCCCTCCCTGTGTCCAGG - Intergenic
943499661 2:188671147-188671169 ATGTTCCCTGCCCTGTGTCCAGG - Intergenic
943500314 2:188680762-188680784 ATGTTCCCCTTCCTATGTCCAGG + Intergenic
943573438 2:189602010-189602032 ATGTTCCCCTTCCTGTGTCCAGG - Intergenic
944094841 2:195954210-195954232 ATGTTCCCCTTCCTGTGTCCAGG + Intronic
944164550 2:196704733-196704755 ATGTTCCCTGCCCTGTGTCCAGG + Intronic
944233691 2:197422364-197422386 ATGTTCCCCATCCTGTGTCCAGG - Intronic
944312118 2:198245055-198245077 ATATTCCTCTTCATGTGTTCTGG + Intronic
945311837 2:208322878-208322900 ATGTTCCCCTTCCTGTGTCCAGG + Intronic
946069881 2:217024962-217024984 ATGTTTCCCACCCTGTGTCCAGG - Intergenic
946353833 2:219172624-219172646 ATGTTCCCTTTTCAGTGTCATGG - Exonic
946870757 2:224082718-224082740 ATGCTCCCCATTCTCTGTCCTGG - Intergenic
946971816 2:225101916-225101938 ATGTTCCCTGCCCTGTGTCCAGG - Intergenic
947302975 2:228709022-228709044 ATGTTCCTCTCCCTGTGTCCAGG + Intergenic
947393551 2:229664818-229664840 ATGTGCCTATTCCTCTGTCCAGG - Intronic
947423939 2:229965557-229965579 ATGTTCCCCTTCCTGTGTCCAGG + Intronic
947946438 2:234107171-234107193 ATGTTCTCCTTACTGTGTCCAGG - Intergenic
948366788 2:237460651-237460673 TTCTTGCCCTTCCTGAGTCCTGG - Intergenic
949078975 2:242081263-242081285 ATTTGCCCTTTCCAGTGTCCAGG - Intergenic
1169175774 20:3512290-3512312 ATGTTCCCCTTCCTGTGTCCAGG + Intronic
1169562493 20:6817229-6817251 ATGTTCCCCACCCTGTGTCCAGG - Intergenic
1171087988 20:22256086-22256108 ATGTTCCCTGCCCTGTGTCCAGG - Intergenic
1171505603 20:25630633-25630655 ATGTTCCCCGCCCTGTGTCCAGG + Intergenic
1171721890 20:28571334-28571356 TTCTTCCCCTCCCTGTGTCCAGG + Intergenic
1171756183 20:29112172-29112194 TTGTTCCCCTCCCTGTGTCCAGG - Intergenic
1171799015 20:29592751-29592773 ATGTTCCCCTTCCTGTGTCCAGG + Intergenic
1171862159 20:30411245-30411267 TTGTTCTTCTCCCTGTGTCCAGG - Intergenic
1172310439 20:33913786-33913808 TTGCTCCCCATCCTGTGGCCTGG + Intergenic
1173191337 20:40878444-40878466 ATGTTCCTCTTCCTGTGTCCAGG - Intergenic
1173389825 20:42622128-42622150 TTGTTCCTCTACCAGTGTCCTGG + Intronic
1173481277 20:43401612-43401634 ATGTTCCCCTTCCTGTGTCCAGG + Intergenic
1173536706 20:43820289-43820311 GTATTCCCCTTCATGTGTCCAGG - Intergenic
1175608721 20:60332531-60332553 TTGTTCACCTTCCTGCCTCCTGG + Intergenic
1176203534 20:63875586-63875608 ATGTTCCCTTTTCTGTCACCTGG - Intronic
1176659651 21:9622413-9622435 GTGTTCCCATTCCTGTCTCAAGG - Intergenic
1176857096 21:13981773-13981795 CTCTTTCCCTTCCTGTATCCAGG + Intergenic
1176867506 21:14062454-14062476 CTCTTTCCCTTCCTGTATCCAGG - Intergenic
1177322115 21:19536034-19536056 ATGGTCCCCACCCTGTGTCCAGG + Intergenic
1177670050 21:24213190-24213212 ATGTTCCCCTCCCTGTGTCCAGG - Intergenic
1177678049 21:24328133-24328155 ATGTTCCCCTTCCTATGTCCAGG + Intergenic
1177728393 21:24996440-24996462 ATGTTCCCCTCCCTGTGTCCAGG + Intergenic
1177730255 21:25020278-25020300 ATTTTCCCCTGCATGTGACCTGG - Intergenic
1177764804 21:25445104-25445126 CTTTGCCCATTCCTGTGTCCAGG - Intergenic
1178747988 21:35272051-35272073 ATATTCCCCTTCCTGTGTCCAGG - Intronic
1179901989 21:44399180-44399202 CTGTGCCCTTCCCTGTGTCCTGG + Intronic
1180200256 21:46219836-46219858 ATGTGCTCCTTCCTGGGGCCAGG - Intronic
1180295447 22:10930022-10930044 TTCTTCCCCTCCCTGTGTCCAGG + Intergenic
1180413227 22:12636033-12636055 TTGTTCCCCTCCCTGTGTCCAGG - Intergenic
1180746164 22:18090504-18090526 TTCTGCCCCTCCCTGTGTCCCGG + Exonic
1181863089 22:25834449-25834471 ATGTGCCCCTTCCCCTCTCCAGG + Intronic
1181969824 22:26681620-26681642 ATGTTCTCTTTCCTGGGGCCTGG - Intergenic
1182619048 22:31608370-31608392 ATCGTTCCCTTCCTGTGTCTGGG + Intronic
1182954076 22:34404567-34404589 CGTTCCCCCTTCCTGTGTCCAGG - Intergenic
1183192627 22:36331498-36331520 AGGTTCCCCTTCCTCCCTCCTGG - Intronic
1183833914 22:40436242-40436264 CTGTGCCCCTTCCTGTGTGCAGG - Intronic
1183979444 22:41531079-41531101 ATGTTCCCCTTCCTGGGTCCTGG - Intronic
1185020783 22:48373672-48373694 CAGGTCCCCTTCCTGTGGCCTGG - Intergenic
949555277 3:5147202-5147224 ATGTTCCCCACCCTGTGTCCAGG + Intronic
949593275 3:5515936-5515958 ATGTTCCCCACCCTGTGTCCAGG + Intergenic
949611095 3:5704400-5704422 ATGTTCCCCATCCTGTGTCCAGG + Intergenic
949639703 3:6022076-6022098 ATGTTCCCCATCCTGTGTCCAGG + Intergenic
949787524 3:7758336-7758358 ATGGCCCCCTTCCTGGGTTCTGG - Intergenic
949811241 3:8008692-8008714 CTGTTCTCCTTCCTGTGGTCAGG - Intergenic
949898892 3:8793486-8793508 ATGGTCCCTTCCCTGTGTCACGG + Intronic
949960212 3:9305592-9305614 ATGTTCCCCACCCTGTGTCCAGG + Intronic
950173896 3:10858361-10858383 ATGTTCCACTTCCTGTGGGGTGG - Intronic
950308162 3:11932465-11932487 ATGGTCCCCATCCTGTGTCCAGG - Intergenic
950792116 3:15480364-15480386 ATGTTCCCCACCCTGTGTCCAGG + Intronic
951494471 3:23311040-23311062 ATGTTCCCCTTCCTGTGTCCAGG + Intronic
951942692 3:28097897-28097919 ATGTTCCCCTTCCTGTGTCCAGG + Intergenic
952108472 3:30095666-30095688 ATGTTCCCTGCCCTGTGTCCAGG - Intergenic
952120554 3:30238413-30238435 ATTTGCCCATTCCAGTGTCCTGG + Intergenic
952602449 3:35101498-35101520 ATGTTCCCCACCCTGTGTCCAGG + Intergenic
952640908 3:35594410-35594432 ATGTTCCCCTTCCTGTGTCCAGG - Intergenic
952677328 3:36048872-36048894 ATGTTCCCCTTCCTGTGTCCAGG + Intergenic
952687652 3:36168319-36168341 ATGTTCCCCTTCCTGTGTCCAGG + Intergenic
952729168 3:36620828-36620850 ATATTCCTCTTCCTGTGACCAGG + Intergenic
953080753 3:39615181-39615203 ATGTTCCCCACCCTGTGTCCAGG + Intergenic
953129000 3:40119726-40119748 ATGTTCCCCTTCCTGTGTCCAGG - Intronic
953506321 3:43489128-43489150 ATATTCCCCTTCCTGTGTCCAGG - Intronic
953508333 3:43508752-43508774 ATGTTCCCCTTCCTGTGTCCAGG - Intronic
954061822 3:48074266-48074288 ACGTTCCCCACCCTGTGTCCAGG - Intronic
954492306 3:50917942-50917964 ATGTTCCCCACCCTGTGTCCAGG + Intronic
954527998 3:51290493-51290515 ATGCTCCCCTTCCTGTGTCCAGG - Intronic
954924891 3:54225136-54225158 ATGTTCCCCTTCCTGTGTCCAGG + Intronic
954930689 3:54278792-54278814 ATGTTCCCCTCCCCGTGTCCAGG - Intronic
955006815 3:54976313-54976335 ATGTTCCCCTTCCTGTTGTGGGG + Intronic
955582965 3:60444653-60444675 ATGTTCCCTTTCCTGTGTCCAGG - Intronic
955822909 3:62915135-62915157 ATGTTCCCTGCCCTGTGTCCAGG + Intergenic
955865272 3:63375529-63375551 ATGTTCCTTGCCCTGTGTCCAGG - Intronic
955979018 3:64506058-64506080 ATGTTCCCCTTCCTGTGTCCAGG - Intergenic
956453286 3:69394974-69394996 ATGTTCTCCTCCCCGTGTCCAGG - Intronic
956455508 3:69416734-69416756 ATGTTCCCTTCCCTGTGTCCAGG + Intronic
956569271 3:70675850-70675872 ATGTTCCCCTTCCTGTGTCCAGG + Intergenic
957016071 3:75066484-75066506 ATGTTCCCCTTCCTGTGTCCAGG + Intergenic
957383867 3:79470368-79470390 ATGTTCCCTTTCCTGTGTCCAGG - Intronic
957459899 3:80502524-80502546 ATGTGCCCCTCCCTGTGTCTAGG + Intergenic
957678441 3:83401005-83401027 ATGTTCCCCTTCCTGTGTCCAGG - Intergenic
957773131 3:84720038-84720060 ATGTTCCCCTCCCTGTGTCCAGG + Intergenic
957822598 3:85398189-85398211 ATGTTCCCCTTCCTGTGTCCAGG + Intronic
958783342 3:98569339-98569361 ACGTTCCCCTCCCTGTGTCCAGG + Intronic
959029314 3:101279534-101279556 AGGTTCCCCTTCCTCTTTCTGGG - Intronic
959039658 3:101406391-101406413 ATGTTCCCCTTCCTGTGTCCAGG - Intronic
959169362 3:102825993-102826015 ATGTTCACCTTCCTGTGTCCAGG - Intergenic
959261344 3:104084925-104084947 ATGTTCCCCATCCTGTGTCCAGG - Intergenic
959264446 3:104119654-104119676 ATGTTCCCCTTCCTGTGTCCAGG + Intergenic
959407719 3:105980716-105980738 ATGTACCAATTACTGTGTCCAGG - Intergenic
959498563 3:107078978-107079000 ATGTTCCCCTTCCTGTGTCCAGG + Intergenic
959755485 3:109893030-109893052 ATGTTCCCCTTCCTGTGTCCAGG + Intergenic
959845204 3:111024543-111024565 ATATTCCCCTTCATGTGTCCAGG - Intergenic
959900901 3:111661212-111661234 GTGTCCCCCTTCCTGTTCCCAGG - Intronic
959906229 3:111713920-111713942 CAGTACCCCTTCCTGTGGCCAGG + Exonic
959953346 3:112206801-112206823 ATGTTCCTTGCCCTGTGTCCAGG - Intronic
960546456 3:118920068-118920090 GTATTCCCCTTCATGTGTCCAGG - Intronic
961106631 3:124248339-124248361 AGGTTCTCTTTCCTCTGTCCGGG + Intronic
961224982 3:125235908-125235930 ATGTTCCCCTTCCTCTGTCCAGG - Intronic
961907191 3:130275303-130275325 ATTCTTCCCTTCCTATGTCCAGG + Intergenic
961913764 3:130348306-130348328 ATGTTCCCCTCCCTGTGTCCAGG + Intronic
962480048 3:135790067-135790089 ATGTTCCTCGCCTTGTGTCCAGG + Intergenic
962569278 3:136695679-136695701 ATTTTCCCCTTCCTGTGTATGGG - Intronic
962907923 3:139822371-139822393 ATGTCCCCCACCCTTTGTCCAGG - Intergenic
963415768 3:144993834-144993856 ATGTTCCCCTTCCTGTGTCCAGG + Intergenic
964020754 3:152007485-152007507 ATGTTCCCCTTCCTGTGTCCAGG + Intergenic
964173923 3:153802754-153802776 ATGTTCCCCTTCCTGTGTCCAGG - Intergenic
964214905 3:154268526-154268548 ATGTTCCCCACCCTGTGTCCAGG - Intergenic
964240968 3:154594283-154594305 ATGTTCTCCTTCCTGTGTCCAGG + Intergenic
964738461 3:159940916-159940938 ATGTTCCCCTTCCTGTGTCCAGG - Intergenic
964818287 3:160740912-160740934 GTGTTACCCCTCCTTTGTCCTGG + Intergenic
965119620 3:164536733-164536755 ATGTTCCCCTCCCTGTGTCCAGG + Intergenic
965196458 3:165602877-165602899 ATGTTCCCCTTCCTGTGTCCAGG + Intergenic
965223458 3:165957400-165957422 ATGTTCCCATTCCTGTGTCCAGG - Intergenic
965393581 3:168134241-168134263 ATGTTCCCCACCCCATGTCCAGG - Intergenic
965477672 3:169177426-169177448 TTGTTCCCCTCCCTGTGTCCAGG - Intronic
965549950 3:169954293-169954315 AAGTTCCCCTTCTTGTTTCATGG + Intergenic
965982270 3:174707604-174707626 ATGTTCCCCTTCCTGTGTCCAGG - Intronic
966105545 3:176328893-176328915 ATGTTCTCTTTCCTTTGTCCAGG - Intergenic
966632637 3:182095471-182095493 TTGTTCCCCTCCCTGAGCCCAGG + Intergenic
966798373 3:183738585-183738607 GTATTCCCCTTCATGTGTCCAGG + Intronic
967467032 3:189819477-189819499 ATGTTCCCCTTCCTGTGTCCAGG + Intronic
967576053 3:191094685-191094707 ATGTCCCCATTGCTGTTTCCTGG + Intergenic
968208686 3:196827561-196827583 ATGTTCCCCTTCCTGTGTCCAGG - Intronic
968477271 4:817899-817921 ATTTTCCCCATCCGGTGTCAAGG + Intronic
968556163 4:1247521-1247543 GGGTCCCCCTTTCTGTGTCCTGG - Intronic
969209532 4:5676206-5676228 GTCTTCCCCTTTCTGTCTCCTGG - Intronic
969309210 4:6342908-6342930 ATGCTCACCTTCCTGCATCCAGG + Intronic
969434590 4:7180955-7180977 GTGCTCCCCTACCTGTGTACAGG - Intergenic
969457105 4:7306398-7306420 CTGATCCCCTTCCTCTGTTCTGG - Intronic
969590980 4:8121832-8121854 ATCTTTCAGTTCCTGTGTCCAGG + Intronic
970469491 4:16362526-16362548 ACGTTCCCCTCCCTGTGTCCAGG + Intergenic
970904489 4:21199999-21200021 ATGTTCCCCTTCCTGTGTCCAGG - Intronic
970954449 4:21794081-21794103 ATGTTCCCCACCCTGTGTCCAGG - Intronic
971028282 4:22609698-22609720 AGGTTCCCCTACCTTTATCCGGG + Intergenic
971099431 4:23447032-23447054 ATGTTCCCCACCCTGTGTCCAGG + Intergenic
971523277 4:27582598-27582620 ATGTTCCCTGCCCTGTGTCCAGG - Intergenic
971560486 4:28074012-28074034 ATGTTCCCCATCCTGTGCACTGG + Intergenic
971721945 4:30256125-30256147 ATTTTCTCCTTCCTGAGTTCTGG + Intergenic
971849578 4:31966946-31966968 GTATTCCCCTTCATGTGTCCAGG + Intergenic
973167408 4:47094566-47094588 TTGTTCCCCTCTATGTGTCCAGG - Intronic
973315821 4:48759039-48759061 ATGTTCCCCACCGTGTGTCCCGG - Intronic
973660078 4:53095902-53095924 ATGTTCCCCTTCCTGTGCCCAGG + Intronic
973834731 4:54797744-54797766 ATGTTCCCTGCCCTGTGTCCAGG + Intergenic
974114095 4:57559465-57559487 ATGTTCCCCGCCCTGTGTCCCGG + Intergenic
974119286 4:57619517-57619539 ATGTTCCCCTTCCTGTGTCCAGG + Intergenic
974135448 4:57810980-57811002 ATGTTCCCCTTCCTGTGTCCTGG + Intergenic
974656036 4:64823839-64823861 TTGTTCCCCTCCATATGTCCAGG - Intergenic
974671687 4:65038379-65038401 GTGTTCCCCTTCCTGTGTCCAGG - Intergenic
974689070 4:65271767-65271789 ATGTTCCCCATCCTGTGTCCAGG + Intergenic
974830514 4:67182858-67182880 GTATTCCCCTTCATGTGTCCAGG - Intergenic
975050056 4:69851932-69851954 ATGTTCCCCTTCTTGTGTCCAGG - Intronic
975302096 4:72802120-72802142 GTGTTCCTCACCCTGTGTCCAGG - Intergenic
975308768 4:72878957-72878979 ATGTTCCCCTTCCTGTGTCCAGG + Intergenic
975543061 4:75533943-75533965 ATGTTCCCCTTCCTGTGTCCAGG + Intronic
975821102 4:78271497-78271519 ATGTTCCCCTTCCTGTGTCCAGG + Intronic
975907120 4:79226611-79226633 ATGTTCCCCTTCCTGTGTCCAGG + Intronic
975996350 4:80320771-80320793 ATGTTCCCCACCCTGTGTCCAGG + Intronic
976131609 4:81890723-81890745 ATGTTCCCCACCCTGTGTCCAGG - Intronic
976144162 4:82024580-82024602 ATGTTCCCCTTCCTGTGTCCAGG - Intronic
976925408 4:90489704-90489726 ATGTTCCCCTTCCTGTGTCCAGG + Intronic
977002505 4:91521067-91521089 ATGTTCCCCGCAATGTGTCCAGG + Intronic
977036962 4:91966011-91966033 TTGTTCCCCTCTCTGTGTCCTGG + Intergenic
977129884 4:93222648-93222670 ATGTTCCCCATCCTGTGTCCAGG + Intronic
977385865 4:96338406-96338428 ATGTTCCCCTTCCTGTGTCCAGG - Intergenic
977390351 4:96401486-96401508 ATGTTCCCCTTCCTGTGTCCAGG + Intergenic
977469483 4:97424895-97424917 ATGTTCCCCACCCTGTGTCCAGG + Intronic
978616920 4:110606856-110606878 ATGTTCCCCTTCCTGTGTCCAGG + Intergenic
978808486 4:112825147-112825169 ATGTTCCCCACCCTGTGTCCAGG - Intronic
979000414 4:115210319-115210341 ATGTTCCCTGCCCTGTGTCCAGG - Intergenic
979335972 4:119463181-119463203 ATATTTCCCGCCCTGTGTCCAGG + Intergenic
979751260 4:124281893-124281915 GTATTCCCCTTCATGTGTCCAGG - Intergenic
979788767 4:124751158-124751180 TTGCTCCCCTCCCTGTGTCCAGG - Intergenic
979896464 4:126164096-126164118 ATGTTCCCCTTCCTGTGTCCAGG + Intergenic
980173383 4:129316073-129316095 ATGTTCCCCTCCCTGTGTCCTGG - Intergenic
980311946 4:131142429-131142451 ATGTTCCCCTTCCTGTGTCCAGG + Intergenic
981124615 4:141091622-141091644 TTGATCCCCCTCCTGTGTACCGG - Intronic
981172529 4:141641649-141641671 ATGTTCCCCTTCCTGTGTCCAGG - Intronic
981239006 4:142452086-142452108 ATTTTCCCCACCCTGTGTCCAGG + Intronic
981496868 4:145403588-145403610 ATGTTCCCCACCCTGTGTCCAGG - Intergenic
981513220 4:145580269-145580291 ATGTTCCCTGCCCTGTGTCCAGG - Intergenic
981679207 4:147375675-147375697 ATGTTCCCCTTCCTGTGTCCAGG + Intergenic
981679994 4:147386535-147386557 ATGTTCCCCTTCCTGTGTCCAGG - Intergenic
981806015 4:148715926-148715948 ATGCTCCCCTTCCTCATTCCAGG - Intergenic
981851388 4:149234286-149234308 ATGTTCCCCTCCCTGTGTCCAGG + Intergenic
981910786 4:149979444-149979466 ATGTTCCCCTCCCTGTGTCCAGG - Intergenic
982280660 4:153680967-153680989 ATGTTCCCCACCCTGTGTCCAGG - Intergenic
983126560 4:163959738-163959760 ATTTTCCCATTCCTATGTCCAGG - Intronic
983602350 4:169545236-169545258 GTATTCCCCTTCATGTGTCCAGG + Intronic
984290121 4:177783882-177783904 ATGTTCCCCTTCCTGTGTCCAGG - Intronic
984344939 4:178511109-178511131 ATGTTCCCCTTCCTGTGTCCAGG + Intergenic
984380428 4:178985959-178985981 ATGTTCCCCTTCCTGTGTCCAGG + Intergenic
984449135 4:179876779-179876801 ATGTGTCCGTTCCTTTGTCCTGG + Intergenic
985415720 4:189734002-189734024 GTGTTCCCATTCCTGTCTCAAGG + Intergenic
985726252 5:1517283-1517305 ACCTTCCTCTTCCTGTTTCCAGG - Intronic
985928449 5:3035867-3035889 ATTTTCTTTTTCCTGTGTCCTGG + Intergenic
986117178 5:4787143-4787165 ATATTCCCCTTCCTCTGTCCAGG - Intergenic
986344036 5:6817834-6817856 ATGTTCCCCTTCCTGTGTCCAGG + Intergenic
987626394 5:20406391-20406413 ATGGTCCCCTTCCTGTGTCCAGG - Intronic
987693247 5:21295819-21295841 GTGTTCCCCACCCTGTGTCCAGG + Intergenic
988023175 5:25650373-25650395 ATGTTCCCCGCCCTGTGTCCAGG + Intergenic
988269627 5:28996958-28996980 ATATTCCCCTTCCTGTGTCCAGG - Intergenic
988345107 5:30027203-30027225 CTCTTCCCCTTCCTGTGGACTGG + Intergenic
988676383 5:33437272-33437294 ATGTTCCCCTTCCAGTGTCCAGG - Intergenic
988944658 5:36184444-36184466 ATGTTCCCCTTCCTGTGTCCAGG + Intergenic
989599534 5:43188760-43188782 ATGTTCCCCACCCTGTGTCCAGG - Intronic
989607694 5:43260793-43260815 ATGTTCCCCACCCTGTGTCCAGG + Intronic
989847714 5:46166552-46166574 ATGTTCCCCTTCCTGTGTCCAGG + Intergenic
989864083 5:46424575-46424597 ATATTCCCCTTCCTGTGTCCAGG - Intergenic
990124385 5:52496231-52496253 ATGTTCCCCTTCCTGTGTCCAGG + Intergenic
990153613 5:52848760-52848782 ATGTTCCCCTTCCTGTGTCCAGG + Intronic
990248054 5:53882900-53882922 TTGTTCCCCAGCCTGGGTCCTGG - Intergenic
990325954 5:54675493-54675515 TTGTTCCCCTCCCTGTGTCCAGG - Intergenic
990331463 5:54730271-54730293 ATGTTCCCCGCCCTGTGTCCAGG - Intergenic
990374399 5:55154630-55154652 ATCTACCCCTTCATGGGTCCTGG - Intronic
990410451 5:55535517-55535539 ACGTTGACCTCCCTGTGTCCTGG + Intergenic
990489719 5:56292904-56292926 ATGTTCCCCACCCTGTGTCCAGG + Intergenic
991224583 5:64255382-64255404 ATCTTCCCCTTCCTGTGTCCAGG + Intronic
991679416 5:69124190-69124212 AAGTTCCCATTCTTGTGACCTGG + Intronic
991747031 5:69753737-69753759 GTGTTCCCCACCCTGTGTCCAGG - Intergenic
991750674 5:69801505-69801527 GTGTTCCCCACCCTGTGTCCAGG + Intergenic
991798633 5:70333679-70333701 GTGTTCCCCACCCTGTGTCCAGG - Intergenic
991826407 5:70629049-70629071 GTGTTCCCCACCCTGTGTCCAGG - Intergenic
991829962 5:70676402-70676424 GTGTTCCCCACCCTGTGTCCAGG + Intergenic
991890964 5:71333002-71333024 GTGTTCCCCACCCTGTGTCCAGG - Intergenic
992337952 5:75792803-75792825 ATGTTCCCCTTCCTGTGTCCAGG + Intergenic
992550633 5:77856394-77856416 ATGTTCCCCTTCCTGTGTCCAGG - Intronic
992815510 5:80433395-80433417 ATGTTCCCCTTCCTGTGTCCAGG - Intronic
992832338 5:80606401-80606423 ATGTTCCCCCTCCTGTGTCCAGG - Intergenic
993240637 5:85380033-85380055 ATGTTCCCCTTCCTGTGTCCAGG + Intergenic
993330815 5:86597796-86597818 ATGTTCCCCTCCCTGTGTCCAGG - Intergenic
993587347 5:89747105-89747127 ATGCTGCTCTTCCTCTGTCCAGG + Intergenic
993637866 5:90367100-90367122 TTTTTCCCCCTCCTGTTTCCAGG - Intergenic
993655781 5:90576296-90576318 ATGTTCCCCGCTGTGTGTCCAGG + Intronic
993764079 5:91833615-91833637 ATGTTCCCCTCCCTGTGTCCAGG + Intergenic
994142997 5:96362016-96362038 ATGTTCCCCTTCCTGTGTCCAGG + Intergenic
994255911 5:97595775-97595797 TTGTTCCCCTCCCTGTGTCCAGG + Intergenic
994390003 5:99181097-99181119 ATATTCCCCACCCTGTGTCCAGG + Intergenic
994548234 5:101197769-101197791 ATGTTCCCCTCCCTGTGTCTAGG + Intergenic
994694233 5:103054571-103054593 ATGTTCCCCTTCCTGTGTCCAGG + Intergenic
995335281 5:110991541-110991563 ATGTTCCCCTTCCTGTGTCCAGG - Intergenic
995529713 5:113080611-113080633 ATGTTCCACACCGTGTGTCCAGG - Intronic
995729486 5:115222926-115222948 ATGTTCCCCACCCTGTGTCCAGG - Intronic
996108732 5:119539390-119539412 ATGTTCCCCACCCTCTGTCCAGG - Intronic
996229880 5:121049261-121049283 TTGTTCCCCTCCCTATGTCCAGG - Intergenic
996681346 5:126230557-126230579 ATCTGCCTGTTCCTGTGTCCAGG - Intergenic
996785382 5:127231364-127231386 ATGGCCTCCTTCCTGTGTCTTGG + Intergenic
996807841 5:127477749-127477771 GTATTCCCCTTCATGTGTCCAGG - Intergenic
997078086 5:130704886-130704908 ATGTTCCCCTTCCTGTGTCCAGG - Intergenic
997099799 5:130956821-130956843 ATTTGCCCATTCCTATGTCCAGG + Intergenic
997251691 5:132393579-132393601 GTGATCCCCTTCCAGAGTCCTGG + Intronic
997719123 5:136064103-136064125 GTGATCCCCTGCCTGTGTGCTGG + Intergenic
998329400 5:141310659-141310681 ATGTTCCCCTTCCTGTGTCCAGG + Intergenic
998362466 5:141601035-141601057 ATGTTGCCCACCTTGTGTCCAGG - Intronic
998683774 5:144500729-144500751 ATATTCCCCTTCCTGTGTCCAGG - Intergenic
998699901 5:144686150-144686172 ATGTTCCCCTTCCTGTGTCCAGG + Intergenic
999939189 5:156522151-156522173 ATGTTCCCTGCCCTGTGTCCAGG - Intronic
999964017 5:156788754-156788776 ATGTTCCCCACCCTGTGTCCAGG - Intergenic
1000033334 5:157421956-157421978 ATGTTCCCCTTCCTGTGTCCAGG - Intronic
1000192748 5:158927381-158927403 TTGTTCTTCTTCTTGTGTCCCGG + Intronic
1000283998 5:159810753-159810775 ATGTTCCCCTTCCTGTGTCCAGG - Intergenic
1000451053 5:161387279-161387301 ATGTGGGGCTTCCTGTGTCCTGG + Intronic
1000688664 5:164286875-164286897 ATCTTCACCTTCATGAGTCCTGG + Intergenic
1000854413 5:166380547-166380569 ACGTTCCCCACCCTGTGTCCAGG + Intergenic
1000933089 5:167276247-167276269 ATGATCCCCTTCCAATTTCCTGG + Intergenic
1001458408 5:171886380-171886402 ATGTTCCCCTTCCTGTGTCCAGG - Intronic
1001572486 5:172739329-172739351 CTGCTGTCCTTCCTGTGTCCTGG + Intergenic
1001792588 5:174471850-174471872 ATGCTCCCCTCCCTGTGTCCAGG - Intergenic
1002808897 6:606225-606247 ATGGTCCCCTTCCTGTGTCCAGG - Intronic
1003373238 6:5549364-5549386 ATGTTCCCTGCCCTGTGTCCAGG + Intronic
1003467322 6:6393048-6393070 TTTTTCCCCCTCCTGTCTCCTGG + Intergenic
1003831331 6:10015240-10015262 ATGTTCCCCTCCCTGTGTCCAGG + Intronic
1004574195 6:16877780-16877802 CTTTGCCCATTCCTGTGTCCAGG + Intergenic
1004969024 6:20888158-20888180 ATGTTCCCAGCCCTGTGTCCAGG + Intronic
1005121063 6:22389865-22389887 ATGCTGCCCTTCCTCTGCCCAGG + Intergenic
1005713491 6:28524888-28524910 TTGTTCCCCTCTATGTGTCCAGG - Intronic
1005817526 6:29567486-29567508 ATGTTCTCTTTCCTCTGTCTGGG - Intronic
1005904835 6:30253174-30253196 ATATTCCCCTTCCTGTGTCCAGG - Intergenic
1006061701 6:31425400-31425422 ATGTTCTCCACCCCGTGTCCAGG + Intergenic
1006191874 6:32214303-32214325 ATGTTCCCCTCCCTGCTGCCTGG + Intronic
1006210414 6:32388906-32388928 ATGTTCCCCGCCCTGTGTCCAGG + Intergenic
1006880855 6:37338367-37338389 ATGTTCTCCACCCTGTGTCCAGG + Intergenic
1007157646 6:39761384-39761406 TTGTTCCCCTGTCTGTGTCCAGG + Intergenic
1007216179 6:40240613-40240635 CTTTGCCCATTCCTGTGTCCAGG - Intergenic
1007235992 6:40391908-40391930 ATGCTCCCTTTCCTGTGCGCAGG - Exonic
1007360928 6:41355066-41355088 ATGTTCCCCACCCTGTGTCCAGG - Intergenic
1008269767 6:49477378-49477400 ATGATCCCCTTCCTGTGCCCAGG - Intronic
1008407091 6:51130539-51130561 ATATTCCCCTCCCTGTGTCCAGG + Intergenic
1008786133 6:55170765-55170787 ATGTTCCCCTTCCTGTGTCCAGG + Intronic
1008871487 6:56277327-56277349 ATGTTCCCCTTCCTGTGTCCAGG + Intronic
1008957987 6:57236598-57236620 ATGTTCCCCTTCCTGTGTCCAGG + Intergenic
1009274909 6:61663208-61663230 ATGTTCCCCTTCCTGTGTCCAGG - Intergenic
1009374652 6:62952360-62952382 ATGTTCCCCTTCCTGTGTCCAGG - Intergenic
1009665226 6:66669639-66669661 ATCTTCTCCTTCTTGTTTCCTGG + Intergenic
1009982686 6:70744356-70744378 ATGTTCCCCACACTGTGTCCAGG + Intronic
1010082877 6:71885212-71885234 GTGTTCCTCTCCCTGTGTCCGGG - Intergenic
1010347038 6:74824189-74824211 ATGTTCCCCTCCCTGTGTCCAGG + Intergenic
1010449548 6:75987493-75987515 ATGTTCCCCACCCTGTGTCTAGG + Intronic
1010482244 6:76369613-76369635 ATGTTCCCCTTCCTGTGTCCAGG + Intergenic
1010512498 6:76737876-76737898 GTGTTCCCCTTCCTGTGTCCAGG - Intergenic
1010675108 6:78734123-78734145 TTGTTCCCCTCTATGTGTCCAGG - Intergenic
1010685402 6:78848736-78848758 ATCTGCCCATTCCTATGTCCAGG + Intergenic
1010914600 6:81600334-81600356 CTTTGCCCATTCCTGTGTCCAGG - Intronic
1010943983 6:81953220-81953242 ATGTTCCCCTTCCTGTGTCCAGG + Intergenic
1011161577 6:84396820-84396842 ATGTTCCCCTCCCTGTCTCCAGG - Intergenic
1011405762 6:87014068-87014090 GTGTTCCCTGCCCTGTGTCCAGG - Intronic
1011598932 6:89042097-89042119 ATGTTCCCCTTCCTGTGTCCGGG - Intergenic
1011992854 6:93545747-93545769 ATGTTCCCCTTCTTGTGTCCAGG + Intergenic
1012129927 6:95477391-95477413 ATGTTCCCCAGCCTGTGTCCAGG - Intergenic
1012236967 6:96829672-96829694 AGGTTCTCATTCCTTTGTCCTGG - Intronic
1012380341 6:98613291-98613313 ATGTTCCCCTTCATGTGTCCAGG + Intergenic
1012406493 6:98906354-98906376 GTGTTCCCCTGCCTGTGTCCAGG + Intronic
1012411023 6:98957258-98957280 ATGTTCCCCTCCCTGTGTCTAGG - Intergenic
1012479789 6:99653719-99653741 ACATTCCCCTTCCCATGTCCAGG + Intergenic
1012502150 6:99900259-99900281 ATGTTCCCCTTCCTGTGTCCAGG - Intergenic
1012663817 6:101940580-101940602 GTGTTGCCCCTGCTGTGTCCTGG + Intronic
1012757736 6:103253082-103253104 ATGTTCCCTTTCCTGTGTCCAGG - Intergenic
1012892762 6:104915551-104915573 ACGTTCCCCATCTAGTGTCCTGG - Intergenic
1013123902 6:107164349-107164371 ATGTTCCCCTTCCTGTGTCCAGG + Intronic
1013334578 6:109142419-109142441 TTGTTCCCCTCTCTGTGTCCAGG - Intronic
1013610021 6:111785851-111785873 ATGTTCCCCTTCCTGTGTCCAGG + Intronic
1013711798 6:112909655-112909677 ATGTTCCCCATCCTGTGTCCAGG - Intergenic
1013906678 6:115228018-115228040 ATGTTCCCTTTCCTGTGTCCAGG - Intergenic
1014456773 6:121644458-121644480 ATGTTCCCCTCCCTGTATCCAGG - Intergenic
1014585115 6:123188422-123188444 ATGTTCCCCTCCCTGTGTCCAGG - Intergenic
1014946568 6:127505475-127505497 TTGTTCCCCTCCATGTGTCAAGG - Intronic
1014961274 6:127688382-127688404 CTTTGCCCATTCCTGTGTCCAGG + Intergenic
1015534361 6:134252266-134252288 ATGTTTCCAATCCTGTTTCCTGG - Intronic
1016066566 6:139689057-139689079 ATGTTCCCCACCCTGTGTCCAGG - Intergenic
1016160351 6:140871731-140871753 ATGTTCCCCTTCCTGTGTCCAGG - Intergenic
1016451153 6:144183915-144183937 TTATTCCCCTCCCTGTGTCCAGG + Intronic
1016621738 6:146118624-146118646 ATGTTCCCTTTCCTGTGTCCAGG + Intronic
1016660008 6:146567353-146567375 ATGTTCCCCATCCTGTGTCCAGG - Intergenic
1016816392 6:148306835-148306857 ACATTCCCATTCCTGTGGCCAGG - Intronic
1017027385 6:150193237-150193259 TTTTTCTTCTTCCTGTGTCCTGG - Intronic
1017084543 6:150701636-150701658 TTGTTCCCCTTCCTGTGTCCAGG + Intronic
1017151876 6:151288022-151288044 ATGTTCCCCTCCCTGTGTCCAGG - Intronic
1020420271 7:7995709-7995731 ATGTTCCCCTTCCTGTGTCCAGG - Intronic
1020492394 7:8803610-8803632 ATCTTCCCCTTCCTGTGTCCAGG - Intergenic
1020562540 7:9747650-9747672 ACGTTCCCCTTCCTGTGTCCAGG - Intergenic
1020640955 7:10753023-10753045 ATGTTCCCCACCCTGTGTCCAGG - Intergenic
1021048744 7:15956026-15956048 ATGTTCCCCTTCCTGTGTCCAGG + Intergenic
1021307706 7:19051685-19051707 ATGTTCCCCGTCCTGTGTCCAGG - Intronic
1021391755 7:20101901-20101923 ATGTTCCCCTTCCCGCGTCCAGG - Intergenic
1021870013 7:24996450-24996472 ATGTTCCCTGCCCTGCGTCCAGG + Intergenic
1022540016 7:31126551-31126573 ATGTTCCCCACCCTGTGTCCAGG + Intergenic
1022838617 7:34140971-34140993 TTGTTCCCCATCCTCTCTCCTGG - Intronic
1022937090 7:35189387-35189409 ATGTTCCCCTTCCTGTGTCCAGG + Intergenic
1023133317 7:37025625-37025647 ATTTTCCCCTGCCTGTGGACTGG + Intronic
1023370809 7:39510487-39510509 ATGTCCCCCTTCCTGTGTCCAGG - Intergenic
1023734999 7:43226887-43226909 ATGGCCCCCATCCTGTGTTCTGG - Intronic
1024223940 7:47310752-47310774 ATGTTCCCTGCCCTGTGTCCAGG + Intronic
1024694484 7:51840795-51840817 ATGTTCCCCTCCCTGTGTCCAGG + Intergenic
1025597761 7:62952354-62952376 ATGTTCCCCTTCCTGTGTCCAGG - Intergenic
1026099628 7:67373855-67373877 ATGTTCCTCACCCTGTGTCCAGG + Intergenic
1026249121 7:68651915-68651937 ATATTCCCCTTCATGTGTCCAGG + Intergenic
1026637490 7:72097117-72097139 ATATTCCCCTTCCTGTGTCCAGG - Intronic
1027432987 7:78133582-78133604 TTGTGACTCTTCCTGTGTCCAGG - Intronic
1027987925 7:85318591-85318613 TTGTTCCCCTCCCTGTGTCCAGG + Intergenic
1028306920 7:89277532-89277554 ATGTTCCCCTTCCTGTGTCCAGG + Intronic
1029332811 7:99873739-99873761 ATGTTCCCCTTCCTGTGTCCAGG + Intergenic
1029795442 7:102889594-102889616 ATGTTCCCTGCCTTGTGTCCAGG + Intronic
1029849670 7:103448546-103448568 ATGTTCCCCTCCCTGTGTCCAGG + Intergenic
1029903140 7:104063410-104063432 ATGTTCCCCTTCCTGTGTCCAGG + Intergenic
1029975546 7:104829513-104829535 ATGTTCCCCTTCCTGTGTCCAGG + Intronic
1030087957 7:105833149-105833171 ATGTTCCCCTTCCTGCCTCAGGG + Intronic
1030182806 7:106727922-106727944 GTGTTCCCCTTGCTGTGTCCAGG - Intergenic
1030485680 7:110164225-110164247 ATGTTCCCCTTCCTGTGTCCAGG - Intergenic
1030586011 7:111420589-111420611 ATGTTCCCCGCCCTGTGTCCAGG + Intronic
1030600753 7:111589093-111589115 ATATTCCCATTCCTGTTTCCAGG + Intergenic
1030832949 7:114249397-114249419 TTGTTCCCCTCCCTGTGTCCAGG + Intronic
1030897908 7:115084571-115084593 ATGTCCCCCTTCCTGTGTCCAGG - Intergenic
1031238962 7:119214279-119214301 ATGTTCCCCTTCCTGTGTCCAGG + Intergenic
1031366520 7:120906655-120906677 ATGTTCCCCGACCTGTGTCCAGG - Intergenic
1031448704 7:121887081-121887103 ATGTTTCCCTTCCTGTGGAAGGG - Intronic
1031843455 7:126775533-126775555 ATGTTCCCCCTATTGTATCCTGG - Intronic
1032404393 7:131645201-131645223 ACATTCCCTTGCCTGTGTCCTGG - Intergenic
1033839467 7:145356560-145356582 ATGTTACCCTTCCTGTTACATGG - Intergenic
1033899892 7:146124056-146124078 ATGTTCCCCTCCCTGTGCTGAGG - Intronic
1034692631 7:153026013-153026035 ATGTTCCCCACCCTGTGTCCAGG + Intergenic
1035558263 8:583966-583988 ATGTTACCCACCCTGTGTCCAGG + Intergenic
1035592928 8:831398-831420 ATGTTCCCTGCCCTGTGTCCAGG + Intergenic
1035798027 8:2377097-2377119 ATGTTCCCCTCCCTGTGTCCAGG - Intergenic
1036433268 8:8708967-8708989 TTGTTTCCCTCCCTGTGTCCAGG + Intergenic
1037182972 8:16029416-16029438 ATGTTCCCCTTCCTGTGTCCAGG + Intergenic
1037615688 8:20517179-20517201 TTGTTCCCCTCTCTGTGTCTTGG - Intergenic
1038390611 8:27196854-27196876 ATGTTCCCCGCCCTGTGTCCAGG + Intergenic
1038451156 8:27639769-27639791 ATGGTTCTCTGCCTGTGTCCTGG - Intronic
1038980703 8:32756381-32756403 ATGCTCCCTTTCTTATGTCCAGG + Exonic
1040273116 8:45980218-45980240 ATGTTCCCCTTCCTGTGTCCAGG + Intergenic
1040653522 8:49477725-49477747 TTGTTCCCCTCCTTGAGTCCAGG - Intergenic
1040712343 8:50204752-50204774 ATGTTCCCCACTCTGTGTCCAGG + Intronic
1040741734 8:50583955-50583977 ATGTTCCCCTTCCTGCGTCCAGG + Intronic
1041151907 8:54943979-54944001 ATGTTCCCCTTCCTGTGTCCAGG + Intergenic
1041222085 8:55662101-55662123 ATGTTCCCCATCCTGTGTCCAGG - Intergenic
1041691569 8:60693120-60693142 AGACTCCACTTCCTGTGTCCTGG + Intronic
1041886805 8:62818743-62818765 ATGTTCCCTCTTCTGTGTTCTGG - Intronic
1041915757 8:63137187-63137209 ATGCTCTCCTCCCTGTGTCCAGG - Intergenic
1042046231 8:64655094-64655116 ATTTGCCCATTCCTATGTCCAGG - Intronic
1042834023 8:73061702-73061724 ATGTTCCCCGACCTAGGTCCAGG - Intergenic
1043056678 8:75448241-75448263 GTATTCCCCTTCATGTGTCCAGG - Intronic
1043098497 8:76007874-76007896 ATGCTCCCCTTCCTGTGTCCGGG - Intergenic
1043412202 8:80009234-80009256 ATGTTCCCTTTCCTGTGTCCAGG - Intronic
1043593030 8:81851981-81852003 ATATTCCCTGCCCTGTGTCCAGG - Intergenic
1043687730 8:83108554-83108576 GTATTCCCTTTCCTGTTTCCTGG - Intergenic
1043708297 8:83380402-83380424 ATGTTCCCATTCCTGATCCCTGG + Intergenic
1044292234 8:90486135-90486157 ATGTTCCTCGCCCTGTGTCAAGG + Intergenic
1045606182 8:103779711-103779733 GTGCTCCCCACCCTGTGTCCAGG - Intronic
1045607658 8:103795391-103795413 ATGTTCCCTACTCTGTGTCCAGG - Intronic
1045716346 8:105050490-105050512 ATGTTTCCCACCCTGTGTCCAGG - Intronic
1045922258 8:107545002-107545024 AAGTTCCCTCTCCTGTGTCTGGG - Intergenic
1045962010 8:107979489-107979511 ATGTTCCCCTTCCTGTGTCCAGG - Intronic
1046142129 8:110107677-110107699 TTGTTCCCCTATATGTGTCCAGG - Intergenic
1046246878 8:111575327-111575349 ATGTTCCCCTTCCTGTGTCCAGG + Intergenic
1046274459 8:111939227-111939249 ATGTTCCCCTTCCTGTGTCCAGG - Intergenic
1046333229 8:112749408-112749430 GTTTTCCCGTTCCTATGTCCAGG + Intronic
1046537214 8:115530888-115530910 ATGTTCCCCTTCCTGTGTCCAGG - Intronic
1046847461 8:118934028-118934050 ATTTTCCCCTCCATGTTTCCAGG - Intronic
1047020394 8:120769501-120769523 AGCTTCCACTTCCTGTCTCCTGG + Intronic
1047931188 8:129729493-129729515 ATGTTCCCCTTCCTGTGTCCAGG + Intergenic
1048657845 8:136562128-136562150 ACGTTCCCCTTCCTGTGTCCAGG - Intergenic
1048723093 8:137349844-137349866 CTTTTCCTGTTCCTGTGTCCAGG + Intergenic
1048726889 8:137396312-137396334 TTGTTCCCCTCCCTGTGTCCAGG + Intergenic
1048769256 8:137877909-137877931 CTGTTCCCCTCCCTGTGTCCAGG + Intergenic
1048842617 8:138578882-138578904 CTGTTTTCATTCCTGTGTCCTGG - Intergenic
1050017099 9:1245568-1245590 ATGTTCCCCTTTCTGTGTCCAGG - Intergenic
1050161825 9:2727242-2727264 ATGTTCCCCTTCCTGTGTCCGGG - Intronic
1050400298 9:5246581-5246603 ATGTTCCCCTCCTCGTGTCCAGG + Intergenic
1050664206 9:7916764-7916786 ATATTCCCCCTCAGGTGTCCAGG - Intergenic
1050855002 9:10343160-10343182 ATGTTCCTCACCCTGTGTCCAGG + Intronic
1050891126 9:10825862-10825884 ATTTGCCCGTTCCTATGTCCAGG + Intergenic
1051043801 9:12849020-12849042 ATGTTCCCCTTCTTGTGTGATGG - Intergenic
1051238907 9:15031149-15031171 ATGTTCCCTTCCCTGTGTCCAGG - Intergenic
1051293399 9:15568964-15568986 CTTTGCCCATTCCTGTGTCCAGG + Intronic
1051492518 9:17682513-17682535 TGGTTCCCCTCCCTGTGTCCAGG - Intronic
1051614154 9:18991524-18991546 ATGTTCCCTGTCCTGTGTCTAGG - Intronic
1051886534 9:21899191-21899213 ATGTTCCCCTTCCTGTGTCCAGG - Intronic
1052038317 9:23708451-23708473 ATCTTTCTCTTTCTGTGTCCTGG + Intronic
1052079596 9:24187789-24187811 ATGTTCCCCACCCTGTGTCCAGG - Intergenic
1052530871 9:29682589-29682611 ATGTTCCCCTTCCTGTGTCCAGG - Intergenic
1054678348 9:67882819-67882841 ATGTTCCCCATCCTGTGTCCAGG + Intronic
1054938506 9:70714596-70714618 ATGTTCCCCTTCCTGTGTCCAGG - Intronic
1054940197 9:70732589-70732611 ATGTTCCCCTTCCTGTGTCCAGG - Intronic
1055629331 9:78207189-78207211 ATGTTCCCCTCCCTATGTCCAGG - Intergenic
1055664062 9:78535730-78535752 GTATTCCCCTTCATGTGTCCAGG - Intergenic
1055863661 9:80786270-80786292 ATGTTCCCCACCCTATGTCCAGG - Intergenic
1056057711 9:82845024-82845046 CTGTTCCCCTCCATGTGTCCAGG + Intergenic
1056221812 9:84457158-84457180 ATGTTCCCCTTCCTATGTCCAGG + Intergenic
1056388026 9:86115691-86115713 GTGTTCCCCTTCCTGTGTCCAGG - Intergenic
1056679981 9:88708708-88708730 ATGTTCCCCTCCCTGTGTCCAGG - Intergenic
1056804738 9:89719870-89719892 ATGTGCCCCTTACTCTATCCAGG + Intergenic
1057197392 9:93122543-93122565 CTCTTCTCCTTCCTGAGTCCGGG - Intronic
1058121492 9:101144224-101144246 ATGTTCCCCACCCTGTATCCAGG - Intronic
1058131868 9:101262962-101262984 ATGTTCCACTCCCTGTGTCCAGG - Intronic
1058305277 9:103433771-103433793 ATGTTCCCCTTCCTGTGTCCAGG + Intergenic
1058554634 9:106153829-106153851 GTGTTCCCCTTCCTGTGTCCAGG - Intergenic
1058975409 9:110121479-110121501 AGGTTCCCCTCCCTGCTTCCTGG - Intronic
1059410913 9:114131779-114131801 CTGTTCCCCTTTCTGGGTTCTGG + Intergenic
1059594418 9:115702642-115702664 ATGTTCCCCTTCCTGTGTCCAGG - Intergenic
1059999483 9:119945123-119945145 ATTTTTCCCTTCCTGAGTGCTGG - Intergenic
1060016877 9:120094515-120094537 ATGCTCCCATTCCTGCATCCTGG + Intergenic
1060171829 9:121468202-121468224 ATGTTCCCCTCCCTGTGTCCAGG + Intergenic
1060529550 9:124340205-124340227 ATGTTCCTGTCCCTTTGTCCAGG - Intronic
1061616456 9:131783160-131783182 ATTTGCCCATTCCTATGTCCAGG + Intergenic
1202802323 9_KI270720v1_random:11122-11144 TTGTTCCCCTCCCTGTGTCCAGG + Intergenic
1203446877 Un_GL000219v1:64889-64911 TTGTTCCCCTCCCTGTGTCCAGG + Intergenic
1203637210 Un_KI270750v1:124256-124278 GTGTTCCCATTCCTGTCTCAAGG - Intergenic
1185762192 X:2697136-2697158 TTGTTCCGCTCCCTCTGTCCCGG + Intronic
1186475616 X:9855108-9855130 ATGTTTCCCTCCCTGTGTCCAGG - Intronic
1186624205 X:11274814-11274836 TTGCTCCCCTTCCTGTGTCCAGG + Intronic
1186913778 X:14197938-14197960 ATGTTCCCCATCCTGTGTCCAGG + Intergenic
1186913985 X:14200153-14200175 ATGTTCCCCTTCCTGTGTCCAGG + Intergenic
1187597998 X:20796196-20796218 ATGCTCCCCTCCCTATGTTCAGG + Intergenic
1187606573 X:20891161-20891183 CTTTACCCCTCCCTGTGTCCAGG - Intergenic
1187760529 X:22579216-22579238 AAGTTCCCCACCCTGTGTCCAGG + Intergenic
1188126790 X:26377926-26377948 ATGTTCCCCACCCTGTGTCCAGG + Intergenic
1188253397 X:27928174-27928196 GTATTCCCCTTCATGTGTCCAGG - Intergenic
1188319656 X:28720783-28720805 ATGTTCCCCTTCCTGTGTCCAGG + Intronic
1188363980 X:29291588-29291610 ATGTTCCCCTCCATGTGTCCAGG + Intronic
1188451343 X:30310369-30310391 TTGTTCCCCTCCTAGTGTCCAGG + Intergenic
1188579367 X:31690926-31690948 ATGTTCCCCTTCCTGCGTCCAGG - Intronic
1188635530 X:32426052-32426074 CTTTTCCCATTCCTATGTCCAGG - Intronic
1188968969 X:36589666-36589688 ATGTTCCCCACCCTGTGTCCAGG + Intergenic
1189051573 X:37650912-37650934 ATGTTCCCCACCTTGTGTCCAGG + Intronic
1189051650 X:37651784-37651806 ATGTTCCCCTTCCTGTGTCCAGG + Intronic
1189133867 X:38529128-38529150 ACGTTCCCCATCCTGTGTCCAGG - Intronic
1190727139 X:53197048-53197070 TTGTTCTTCATCCTGTGTCCTGG - Intronic
1191863510 X:65685315-65685337 ATGGTCCCCTTCCTGTTTTGTGG + Intronic
1191985371 X:66974208-66974230 ATGTTTCCCACCATGTGTCCAGG + Intergenic
1191994899 X:67082596-67082618 ATGTTTCCCTCCCTGGGTCCAGG + Intergenic
1192022896 X:67413259-67413281 ATGTTCCCCTTCCTGTGTCCAGG + Intergenic
1192048769 X:67703828-67703850 ATGTTCCCCTTCCTGTGTCCAGG + Intronic
1192142373 X:68656816-68656838 ATGTTCCCCTTCCTGTGTCCAGG - Intronic
1192475820 X:71441850-71441872 ATGTTCCCCACCTTGTGTCCAGG + Intronic
1192534459 X:71915402-71915424 ACCTTCCCCTTTCTGGGTCCGGG - Intergenic
1192721856 X:73707342-73707364 ATGTTCCCCGCCCTGTGTCCAGG - Intergenic
1193036388 X:76956105-76956127 ATGTTCCTCACCCTGTGTCCAGG - Intergenic
1193127109 X:77881447-77881469 ATGTTCCCCTTCCTGGGTCCAGG + Intronic
1193157206 X:78186837-78186859 ATGTTCCCCACCCTGTGCCCAGG - Intergenic
1193195461 X:78626304-78626326 ATGTTTCCCTCCCTGTGTCCAGG + Intergenic
1193374392 X:80741092-80741114 ATGTTCCCCTTCCTGTGTCCAGG + Intronic
1193376927 X:80772426-80772448 ATGTTCCCCGCCCTGTGTCCAGG - Intronic
1193417780 X:81244830-81244852 ATGTTCCCCTCCCTGTGTTCAGG + Intronic
1193710138 X:84869740-84869762 ATGCTCCCCACCCTGTGTCCAGG - Intergenic
1194344395 X:92745235-92745257 TTGTTCCCCTTTTTATGTCCAGG + Intergenic
1194632360 X:96300777-96300799 ATTTGCCCATTCCTATGTCCAGG - Intergenic
1194990028 X:100537310-100537332 ATGTTCCCCACCCTGTGTCCAGG + Intergenic
1195156208 X:102126292-102126314 CGGTTCCCTTTCCTGAGTCCAGG - Intronic
1195306226 X:103586138-103586160 CGGTTCCCTTTCCTGAGTCCAGG - Exonic
1195308537 X:103608523-103608545 CGGTTCCCTTTCCTGAGTCCAGG - Intronic
1195436217 X:104846379-104846401 ATGTTCCCCTTCCTGTGTCCAGG + Intronic
1195843739 X:109203691-109203713 ATGTTCCCCTCCCTGTTTCCAGG + Intergenic
1196027484 X:111056064-111056086 ATTTTCCCCTCCCTGTGACTAGG - Intronic
1196203663 X:112914565-112914587 ATGTTCCCCACTCTGTGTCCAGG + Intergenic
1196467508 X:115987811-115987833 ATGTTCCCCTCCCTGTGTCCAGG - Intergenic
1197087186 X:122492656-122492678 ATGTTCCCCTCCCTGTGTCCAGG + Intergenic
1197445486 X:126548318-126548340 ATGTTACCCTTCCTGTGTCCAGG - Intergenic
1197588415 X:128378158-128378180 ATGTTCCCCTTCCTGTGTCCAGG - Intergenic
1198480833 X:137038480-137038502 ATGTTCCCCTTCCTGTTGTGGGG + Intergenic
1198918850 X:141702870-141702892 ATGTTCCCCTTCCTGTGTGCAGG + Intergenic
1198928294 X:141823836-141823858 ATGTTCCCCACCCTGTGTCCAGG + Intergenic
1198950684 X:142067917-142067939 ATGTTCCCCTTCCTGTTGTGGGG + Intergenic
1199413093 X:147548342-147548364 ATGTTCCCTTTCCTGTGTCCAGG - Intergenic
1199872432 X:151912098-151912120 AGGGTCCTCTTCCTGGGTCCTGG - Intergenic
1199911285 X:152289699-152289721 ATGTTCCCTGCCCTGTGTCCAGG + Intronic
1200389605 X:155930893-155930915 ATGTTCCCCTTCCTGTGTCCAGG + Intronic
1200652740 Y:5861876-5861898 TTGTTCCCCTTTTTATGTCCAGG + Intergenic
1200733526 Y:6769167-6769189 ATGTTTCCCTTCCTGTGTCCAGG + Intergenic
1200805905 Y:7433609-7433631 ATGTTCGCTTTCCTGTGTCCAGG - Intergenic
1200815069 Y:7522680-7522702 TTGTTCCCCTCTATGTGTCCAGG - Intergenic
1201062760 Y:10062551-10062573 ATGTTCCCCACCCTGTGTCCAGG - Intergenic
1201250000 Y:12047532-12047554 ATGTTCCCCTTCCTGTGTTCAGG - Intergenic
1201560986 Y:15316449-15316471 ATGATCCCCACCCTGCGTCCAGG + Intergenic
1201562997 Y:15337393-15337415 ATGTTCCCCTCCCTGTGCCCAGG + Intergenic
1201618747 Y:15931008-15931030 ATGTTCCCCTTCCTGTGCCCAGG - Intergenic
1202331884 Y:23762272-23762294 ATGTTCCCCTTCCTGTGTCCAGG - Intergenic
1202538885 Y:25907788-25907810 ATGTTCCCCTTCCTGTGTCCAGG + Intergenic
1202577771 Y:26345825-26345847 ATGTTCCCCTTCCTGTGTCCAGG - Intergenic
1202595005 Y:26529420-26529442 ATGCTCCCCTTCCTGTGTCCAGG + Intergenic