ID: 1125397711

View in Genome Browser
Species Human (GRCh38)
Location 15:39268367-39268389
Sequence CTGGGTGAGGGGAAGGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125397701_1125397711 -10 Left 1125397701 15:39268354-39268376 CCGGGGCCTGTCACTGGGTGAGG No data
Right 1125397711 15:39268367-39268389 CTGGGTGAGGGGAAGGGGGAGGG No data
1125397695_1125397711 19 Left 1125397695 15:39268325-39268347 CCTGGACACAGGAAGGGGAACAT 0: 187
1: 148
2: 158
3: 153
4: 341
Right 1125397711 15:39268367-39268389 CTGGGTGAGGGGAAGGGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125397711 Original CRISPR CTGGGTGAGGGGAAGGGGGA GGG Intergenic
No off target data available for this crispr