ID: 1125408809

View in Genome Browser
Species Human (GRCh38)
Location 15:39383429-39383451
Sequence ATGTGAGGATATTAGGAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125408809_1125408816 12 Left 1125408809 15:39383429-39383451 CCCACTTCCTAATATCCTCACAT No data
Right 1125408816 15:39383464-39383486 TTCCAAAATGTGGATTTTTTGGG No data
1125408809_1125408820 15 Left 1125408809 15:39383429-39383451 CCCACTTCCTAATATCCTCACAT No data
Right 1125408820 15:39383467-39383489 CAAAATGTGGATTTTTTGGGGGG No data
1125408809_1125408819 14 Left 1125408809 15:39383429-39383451 CCCACTTCCTAATATCCTCACAT No data
Right 1125408819 15:39383466-39383488 CCAAAATGTGGATTTTTTGGGGG No data
1125408809_1125408815 11 Left 1125408809 15:39383429-39383451 CCCACTTCCTAATATCCTCACAT No data
Right 1125408815 15:39383463-39383485 ATTCCAAAATGTGGATTTTTTGG No data
1125408809_1125408817 13 Left 1125408809 15:39383429-39383451 CCCACTTCCTAATATCCTCACAT No data
Right 1125408817 15:39383465-39383487 TCCAAAATGTGGATTTTTTGGGG No data
1125408809_1125408814 2 Left 1125408809 15:39383429-39383451 CCCACTTCCTAATATCCTCACAT No data
Right 1125408814 15:39383454-39383476 GGAATTAAAATTCCAAAATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125408809 Original CRISPR ATGTGAGGATATTAGGAAGT GGG (reversed) Intergenic
No off target data available for this crispr