ID: 1125412329

View in Genome Browser
Species Human (GRCh38)
Location 15:39418289-39418311
Sequence GAGGGGTACATGCGGTGGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125412318_1125412329 24 Left 1125412318 15:39418242-39418264 CCTGTGTTTCCATCTGACCGATG No data
Right 1125412329 15:39418289-39418311 GAGGGGTACATGCGGTGGATGGG No data
1125412321_1125412329 7 Left 1125412321 15:39418259-39418281 CCGATGAAGGCAAGCAGAGCAGA No data
Right 1125412329 15:39418289-39418311 GAGGGGTACATGCGGTGGATGGG No data
1125412320_1125412329 15 Left 1125412320 15:39418251-39418273 CCATCTGACCGATGAAGGCAAGC No data
Right 1125412329 15:39418289-39418311 GAGGGGTACATGCGGTGGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125412329 Original CRISPR GAGGGGTACATGCGGTGGAT GGG Intergenic
No off target data available for this crispr