ID: 1125413427

View in Genome Browser
Species Human (GRCh38)
Location 15:39428567-39428589
Sequence ATGGTGAAGTGGAATGATAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125413427_1125413430 -4 Left 1125413427 15:39428567-39428589 CCATTATCATTCCACTTCACCAT No data
Right 1125413430 15:39428586-39428608 CCATCTCTCCCCCTGAAGCAAGG No data
1125413427_1125413438 24 Left 1125413427 15:39428567-39428589 CCATTATCATTCCACTTCACCAT No data
Right 1125413438 15:39428614-39428636 AGACAAGGAGAAGGAAGGCCAGG No data
1125413427_1125413437 19 Left 1125413427 15:39428567-39428589 CCATTATCATTCCACTTCACCAT No data
Right 1125413437 15:39428609-39428631 TCAAGAGACAAGGAGAAGGAAGG No data
1125413427_1125413435 9 Left 1125413427 15:39428567-39428589 CCATTATCATTCCACTTCACCAT No data
Right 1125413435 15:39428599-39428621 TGAAGCAAGGTCAAGAGACAAGG No data
1125413427_1125413436 15 Left 1125413427 15:39428567-39428589 CCATTATCATTCCACTTCACCAT No data
Right 1125413436 15:39428605-39428627 AAGGTCAAGAGACAAGGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125413427 Original CRISPR ATGGTGAAGTGGAATGATAA TGG (reversed) Intergenic
No off target data available for this crispr