ID: 1125414938

View in Genome Browser
Species Human (GRCh38)
Location 15:39442479-39442501
Sequence AATTCCATCTAGCAGAGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125414938_1125414941 5 Left 1125414938 15:39442479-39442501 CCTTCACTCTGCTAGATGGAATT No data
Right 1125414941 15:39442507-39442529 ATGCTAGCAGGCTGTGGCTAAGG No data
1125414938_1125414942 23 Left 1125414938 15:39442479-39442501 CCTTCACTCTGCTAGATGGAATT No data
Right 1125414942 15:39442525-39442547 TAAGGTATGTCAGACCCAGCCGG No data
1125414938_1125414939 -7 Left 1125414938 15:39442479-39442501 CCTTCACTCTGCTAGATGGAATT No data
Right 1125414939 15:39442495-39442517 TGGAATTTCTAAATGCTAGCAGG No data
1125414938_1125414940 -1 Left 1125414938 15:39442479-39442501 CCTTCACTCTGCTAGATGGAATT No data
Right 1125414940 15:39442501-39442523 TTCTAAATGCTAGCAGGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125414938 Original CRISPR AATTCCATCTAGCAGAGTGA AGG (reversed) Intergenic
No off target data available for this crispr