ID: 1125417305

View in Genome Browser
Species Human (GRCh38)
Location 15:39467116-39467138
Sequence GCCTGGGCCTCTGTGTGTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125417292_1125417305 15 Left 1125417292 15:39467078-39467100 CCCTCATCTGATTCTCTTGCCTC No data
Right 1125417305 15:39467116-39467138 GCCTGGGCCTCTGTGTGTCCTGG No data
1125417298_1125417305 -4 Left 1125417298 15:39467097-39467119 CCTCCTTCCCTGGGCCTGGGCCT No data
Right 1125417305 15:39467116-39467138 GCCTGGGCCTCTGTGTGTCCTGG No data
1125417300_1125417305 -7 Left 1125417300 15:39467100-39467122 CCTTCCCTGGGCCTGGGCCTGGG No data
Right 1125417305 15:39467116-39467138 GCCTGGGCCTCTGTGTGTCCTGG No data
1125417291_1125417305 18 Left 1125417291 15:39467075-39467097 CCTCCCTCATCTGATTCTCTTGC No data
Right 1125417305 15:39467116-39467138 GCCTGGGCCTCTGTGTGTCCTGG No data
1125417293_1125417305 14 Left 1125417293 15:39467079-39467101 CCTCATCTGATTCTCTTGCCTCC No data
Right 1125417305 15:39467116-39467138 GCCTGGGCCTCTGTGTGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125417305 Original CRISPR GCCTGGGCCTCTGTGTGTCC TGG Intergenic
No off target data available for this crispr