ID: 1125418395

View in Genome Browser
Species Human (GRCh38)
Location 15:39477178-39477200
Sequence GAAGTTTAGAATCTATTTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125418395_1125418398 6 Left 1125418395 15:39477178-39477200 CCCATAAATAGATTCTAAACTTC No data
Right 1125418398 15:39477207-39477229 TTCACCAAAAATAAACTAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125418395 Original CRISPR GAAGTTTAGAATCTATTTAT GGG (reversed) Intergenic
No off target data available for this crispr