ID: 1125419431

View in Genome Browser
Species Human (GRCh38)
Location 15:39489423-39489445
Sequence CTGTTGTCCATGATGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125419426_1125419431 25 Left 1125419426 15:39489375-39489397 CCACTCCTAAAAACCACGAATTA No data
Right 1125419431 15:39489423-39489445 CTGTTGTCCATGATGGAAGAAGG No data
1125419427_1125419431 20 Left 1125419427 15:39489380-39489402 CCTAAAAACCACGAATTAGAAGG No data
Right 1125419431 15:39489423-39489445 CTGTTGTCCATGATGGAAGAAGG No data
1125419429_1125419431 12 Left 1125419429 15:39489388-39489410 CCACGAATTAGAAGGCTGATTTG No data
Right 1125419431 15:39489423-39489445 CTGTTGTCCATGATGGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125419431 Original CRISPR CTGTTGTCCATGATGGAAGA AGG Intergenic
No off target data available for this crispr