ID: 1125422646

View in Genome Browser
Species Human (GRCh38)
Location 15:39519914-39519936
Sequence CTGGGTAGGAACGCTGCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125422646_1125422651 -2 Left 1125422646 15:39519914-39519936 CCAGCAGCAGCGTTCCTACCCAG No data
Right 1125422651 15:39519935-39519957 AGGTGTCCACCTGTCACCACTGG No data
1125422646_1125422652 -1 Left 1125422646 15:39519914-39519936 CCAGCAGCAGCGTTCCTACCCAG No data
Right 1125422652 15:39519936-39519958 GGTGTCCACCTGTCACCACTGGG No data
1125422646_1125422656 5 Left 1125422646 15:39519914-39519936 CCAGCAGCAGCGTTCCTACCCAG No data
Right 1125422656 15:39519942-39519964 CACCTGTCACCACTGGGCAGGGG No data
1125422646_1125422653 3 Left 1125422646 15:39519914-39519936 CCAGCAGCAGCGTTCCTACCCAG No data
Right 1125422653 15:39519940-39519962 TCCACCTGTCACCACTGGGCAGG No data
1125422646_1125422655 4 Left 1125422646 15:39519914-39519936 CCAGCAGCAGCGTTCCTACCCAG No data
Right 1125422655 15:39519941-39519963 CCACCTGTCACCACTGGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125422646 Original CRISPR CTGGGTAGGAACGCTGCTGC TGG (reversed) Intergenic
No off target data available for this crispr