ID: 1125424243

View in Genome Browser
Species Human (GRCh38)
Location 15:39533468-39533490
Sequence GGACCCTGTGGCCCAATAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125424243_1125424250 13 Left 1125424243 15:39533468-39533490 CCCTTTATTGGGCCACAGGGTCC No data
Right 1125424250 15:39533504-39533526 AAGAATAGGCTGCCTGACTAGGG No data
1125424243_1125424249 12 Left 1125424243 15:39533468-39533490 CCCTTTATTGGGCCACAGGGTCC No data
Right 1125424249 15:39533503-39533525 AAAGAATAGGCTGCCTGACTAGG No data
1125424243_1125424252 30 Left 1125424243 15:39533468-39533490 CCCTTTATTGGGCCACAGGGTCC No data
Right 1125424252 15:39533521-39533543 CTAGGGTCTTCCCAGATTTTTGG No data
1125424243_1125424248 -1 Left 1125424243 15:39533468-39533490 CCCTTTATTGGGCCACAGGGTCC No data
Right 1125424248 15:39533490-39533512 CCTCTCATTTCTCAAAGAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125424243 Original CRISPR GGACCCTGTGGCCCAATAAA GGG (reversed) Intergenic
No off target data available for this crispr