ID: 1125426401

View in Genome Browser
Species Human (GRCh38)
Location 15:39553670-39553692
Sequence GGTCTATGGACCCTGAGCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125426401_1125426407 -4 Left 1125426401 15:39553670-39553692 CCCAGGCTCAGGGTCCATAGACC No data
Right 1125426407 15:39553689-39553711 GACCAGGCCCCAGGGCCTACTGG No data
1125426401_1125426416 14 Left 1125426401 15:39553670-39553692 CCCAGGCTCAGGGTCCATAGACC No data
Right 1125426416 15:39553707-39553729 ACTGGGGCCAGTCAGTATGGTGG No data
1125426401_1125426408 -3 Left 1125426401 15:39553670-39553692 CCCAGGCTCAGGGTCCATAGACC No data
Right 1125426408 15:39553690-39553712 ACCAGGCCCCAGGGCCTACTGGG No data
1125426401_1125426415 11 Left 1125426401 15:39553670-39553692 CCCAGGCTCAGGGTCCATAGACC No data
Right 1125426415 15:39553704-39553726 CCTACTGGGGCCAGTCAGTATGG No data
1125426401_1125426410 -2 Left 1125426401 15:39553670-39553692 CCCAGGCTCAGGGTCCATAGACC No data
Right 1125426410 15:39553691-39553713 CCAGGCCCCAGGGCCTACTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125426401 Original CRISPR GGTCTATGGACCCTGAGCCT GGG (reversed) Intergenic
No off target data available for this crispr