ID: 1125426407

View in Genome Browser
Species Human (GRCh38)
Location 15:39553689-39553711
Sequence GACCAGGCCCCAGGGCCTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125426396_1125426407 30 Left 1125426396 15:39553636-39553658 CCTCTCCATCAGGGAGAGGTAAC No data
Right 1125426407 15:39553689-39553711 GACCAGGCCCCAGGGCCTACTGG No data
1125426402_1125426407 -5 Left 1125426402 15:39553671-39553693 CCAGGCTCAGGGTCCATAGACCA No data
Right 1125426407 15:39553689-39553711 GACCAGGCCCCAGGGCCTACTGG No data
1125426401_1125426407 -4 Left 1125426401 15:39553670-39553692 CCCAGGCTCAGGGTCCATAGACC No data
Right 1125426407 15:39553689-39553711 GACCAGGCCCCAGGGCCTACTGG No data
1125426397_1125426407 25 Left 1125426397 15:39553641-39553663 CCATCAGGGAGAGGTAACAGAAG No data
Right 1125426407 15:39553689-39553711 GACCAGGCCCCAGGGCCTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125426407 Original CRISPR GACCAGGCCCCAGGGCCTAC TGG Intergenic
No off target data available for this crispr