ID: 1125426410

View in Genome Browser
Species Human (GRCh38)
Location 15:39553691-39553713
Sequence CCAGGCCCCAGGGCCTACTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125426397_1125426410 27 Left 1125426397 15:39553641-39553663 CCATCAGGGAGAGGTAACAGAAG No data
Right 1125426410 15:39553691-39553713 CCAGGCCCCAGGGCCTACTGGGG No data
1125426401_1125426410 -2 Left 1125426401 15:39553670-39553692 CCCAGGCTCAGGGTCCATAGACC No data
Right 1125426410 15:39553691-39553713 CCAGGCCCCAGGGCCTACTGGGG No data
1125426402_1125426410 -3 Left 1125426402 15:39553671-39553693 CCAGGCTCAGGGTCCATAGACCA No data
Right 1125426410 15:39553691-39553713 CCAGGCCCCAGGGCCTACTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125426410 Original CRISPR CCAGGCCCCAGGGCCTACTG GGG Intergenic
No off target data available for this crispr