ID: 1125426415

View in Genome Browser
Species Human (GRCh38)
Location 15:39553704-39553726
Sequence CCTACTGGGGCCAGTCAGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125426401_1125426415 11 Left 1125426401 15:39553670-39553692 CCCAGGCTCAGGGTCCATAGACC No data
Right 1125426415 15:39553704-39553726 CCTACTGGGGCCAGTCAGTATGG No data
1125426406_1125426415 -3 Left 1125426406 15:39553684-39553706 CCATAGACCAGGCCCCAGGGCCT No data
Right 1125426415 15:39553704-39553726 CCTACTGGGGCCAGTCAGTATGG No data
1125426409_1125426415 -10 Left 1125426409 15:39553691-39553713 CCAGGCCCCAGGGCCTACTGGGG No data
Right 1125426415 15:39553704-39553726 CCTACTGGGGCCAGTCAGTATGG No data
1125426402_1125426415 10 Left 1125426402 15:39553671-39553693 CCAGGCTCAGGGTCCATAGACCA No data
Right 1125426415 15:39553704-39553726 CCTACTGGGGCCAGTCAGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125426415 Original CRISPR CCTACTGGGGCCAGTCAGTA TGG Intergenic
No off target data available for this crispr