ID: 1125426416

View in Genome Browser
Species Human (GRCh38)
Location 15:39553707-39553729
Sequence ACTGGGGCCAGTCAGTATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125426409_1125426416 -7 Left 1125426409 15:39553691-39553713 CCAGGCCCCAGGGCCTACTGGGG No data
Right 1125426416 15:39553707-39553729 ACTGGGGCCAGTCAGTATGGTGG No data
1125426406_1125426416 0 Left 1125426406 15:39553684-39553706 CCATAGACCAGGCCCCAGGGCCT No data
Right 1125426416 15:39553707-39553729 ACTGGGGCCAGTCAGTATGGTGG No data
1125426401_1125426416 14 Left 1125426401 15:39553670-39553692 CCCAGGCTCAGGGTCCATAGACC No data
Right 1125426416 15:39553707-39553729 ACTGGGGCCAGTCAGTATGGTGG No data
1125426402_1125426416 13 Left 1125426402 15:39553671-39553693 CCAGGCTCAGGGTCCATAGACCA No data
Right 1125426416 15:39553707-39553729 ACTGGGGCCAGTCAGTATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125426416 Original CRISPR ACTGGGGCCAGTCAGTATGG TGG Intergenic
No off target data available for this crispr