ID: 1125426812

View in Genome Browser
Species Human (GRCh38)
Location 15:39556981-39557003
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1341
Summary {0: 6, 1: 26, 2: 40, 3: 159, 4: 1110}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125426812_1125426817 9 Left 1125426812 15:39556981-39557003 CCTTCCTCATCCCTCTTTTCCAT 0: 6
1: 26
2: 40
3: 159
4: 1110
Right 1125426817 15:39557013-39557035 GAGACAGAAACTAAAAGCCATGG 0: 4
1: 65
2: 70
3: 71
4: 561
1125426812_1125426818 16 Left 1125426812 15:39556981-39557003 CCTTCCTCATCCCTCTTTTCCAT 0: 6
1: 26
2: 40
3: 159
4: 1110
Right 1125426818 15:39557020-39557042 AAACTAAAAGCCATGGCTTCAGG 0: 4
1: 58
2: 53
3: 53
4: 294

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125426812 Original CRISPR ATGGAAAAGAGGGATGAGGA AGG (reversed) Intergenic
900149084 1:1170500-1170522 ATGGAGGAGAGGAAGGAGGAGGG - Intergenic
900384087 1:2401410-2401432 ATGGGAGAGAGGAAGGAGGAAGG - Intronic
900522302 1:3111551-3111573 AAGGAAGAGAAGGAGGAGGAAGG + Intronic
900594207 1:3473052-3473074 AAGGCAAGGAGGGGTGAGGAGGG - Intronic
900856278 1:5187431-5187453 TTGGAAATGGGGGATGGGGATGG + Intergenic
901105124 1:6749445-6749467 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
901291442 1:8127351-8127373 ACAGAAGAGAGGGATGGGGAAGG - Intergenic
901752450 1:11419068-11419090 ATGGAACAGAGTGATGAAGAGGG - Intergenic
902391196 1:16107934-16107956 CTGGAAAAGAAAGATCAGGAGGG + Intergenic
902606507 1:17572268-17572290 ATGGAGCAGGGGGCTGAGGAGGG - Intronic
902719142 1:18292522-18292544 CTGGAAAACAGGGATGGGGTAGG - Intronic
902729189 1:18357426-18357448 ACGGAGATGAGGGATGAGGTGGG + Intronic
902729202 1:18357462-18357484 ATGGAGATGGGGGATGAGGTGGG + Intronic
902870977 1:19313292-19313314 GTGGAAGAGAGAGAAGAGGAAGG - Intronic
904179400 1:28655314-28655336 TTGGGAAAGAGGTATGTGGATGG - Intergenic
904262586 1:29298375-29298397 TTGGAAAAGAAGGAAGTGGAAGG - Intronic
904302786 1:29566193-29566215 GTGGAAAAGAGAGGTGAGGAAGG + Intergenic
904390744 1:30184252-30184274 GTGGGAAAGAGGGAGGGGGAGGG - Intergenic
904434984 1:30488984-30489006 ATGGTAATGAGTGATGGGGATGG + Intergenic
904686804 1:32266655-32266677 GGGGAGGAGAGGGATGAGGAGGG - Intronic
904945961 1:34198914-34198936 CTGGAGAAGAGGTAGGAGGAAGG - Intronic
905025657 1:34847662-34847684 ATTGAAAATAGAGATGGGGAAGG - Intronic
905068114 1:35201099-35201121 CTGGAAAATAGGAAGGAGGAAGG - Intergenic
905203703 1:36330671-36330693 ATGGAGGAGATGGTTGAGGAAGG - Intergenic
905352121 1:37355096-37355118 AGGGAAAAGAGGAAGGAGGGAGG + Intergenic
905942944 1:41878760-41878782 TAGGAAGAGAGGGAGGAGGAGGG - Intronic
906001704 1:42431917-42431939 AAAGAAAAGAGGGAGGAGGGAGG + Intronic
906069961 1:43008920-43008942 ATGGGAATGTGGGAGGAGGAGGG + Intergenic
906302282 1:44691584-44691606 GTAGAGAAGAGGGACGAGGATGG - Intronic
906383553 1:45347972-45347994 CTGATAAAGAGGGATGAGAATGG - Exonic
906954180 1:50358854-50358876 ATGGAGAGGAGGGAAGAGCAGGG + Intergenic
907378793 1:54067545-54067567 AAGGAAAAGAGGAAAGGGGAAGG - Intronic
907420182 1:54341958-54341980 AGGGCAAAGAGGGAGGAGGCTGG + Intronic
907433661 1:54430156-54430178 ATGGAAATGAGGGGAGATGAGGG + Intergenic
907625399 1:56024476-56024498 AAGGAAGAGAGGGAGGGGGAAGG - Intergenic
907680599 1:56559814-56559836 CTGGAAAATGGGGATGAGGAAGG + Intronic
907712727 1:56899301-56899323 ATGGGAAAGAGAGCTAAGGATGG - Intronic
907753886 1:57290522-57290544 AGGGTAAACAGGGATGGGGAAGG + Intronic
907792276 1:57678592-57678614 TAGGAAAAGAGGCCTGAGGAAGG + Intronic
908082817 1:60598653-60598675 AAGGAAAAAAGGGAAGGGGAGGG + Intergenic
908333692 1:63097939-63097961 AAGGAAAAGAAGGATGGGGGAGG + Intergenic
908414449 1:63899178-63899200 ATGAAAGAGACTGATGAGGAAGG - Intronic
909421781 1:75475305-75475327 AAGGAAAGGAATGATGAGGAAGG + Intronic
909659077 1:78062430-78062452 ATGTAAAAGTGGGTGGAGGAAGG + Intronic
909685110 1:78339294-78339316 ATGGGGAGGTGGGATGAGGAAGG - Intronic
909714281 1:78689123-78689145 AAGAAAAAAAGGCATGAGGATGG - Intergenic
910087064 1:83416038-83416060 ATGCAGATGAGAGATGAGGAAGG + Intergenic
910186574 1:84547551-84547573 ATAGTAAAGAGTGATGAGGCAGG + Intergenic
910220177 1:84881738-84881760 ATTGGAAAGGGGGAAGAGGAGGG + Intronic
910272206 1:85408977-85408999 ATGGAAAGGAGGGGTGAAGTTGG - Intronic
910428351 1:87137945-87137967 ATGGAACAGCGGGATGAGCATGG + Intronic
910698931 1:90051169-90051191 ATGCAGAGGAGGGATGAAGAAGG - Intergenic
910757564 1:90708426-90708448 ATGGCAGGGAGGGAGGAGGAGGG + Intergenic
910832435 1:91474275-91474297 GTGCAAAAGAGGAATGAGAAGGG - Intergenic
910889545 1:92002954-92002976 ATGGAACAGAGGGATGGAGGGGG - Intronic
910948303 1:92617366-92617388 TTGGAGAAGAGGTATGTGGATGG + Intronic
911044762 1:93619282-93619304 GTGGAAAAGAGGGATGAGGAAGG + Intronic
911127020 1:94350281-94350303 AAGTAAAAGAGGAATGATGAAGG + Intergenic
911661771 1:100509312-100509334 ACACAAAAGAGGGATGAGGAAGG - Intronic
911705896 1:101012342-101012364 GCAGAAAAGAGGGATGAGGAAGG + Intronic
912226572 1:107741020-107741042 ATGAAAAAGAGGAGAGAGGAGGG + Intronic
912251940 1:108020730-108020752 CTGGGAAAGAGGTATGTGGATGG - Intergenic
912328038 1:108787407-108787429 GTGGAAAAGAGGGATAAGGAAGG - Intronic
913004800 1:114618431-114618453 ATCTAAAAGAGGGAAGAAGAAGG - Exonic
913291338 1:117275072-117275094 ATGAAAAATAGGCATGAGAAGGG - Intergenic
913323714 1:117607781-117607803 GTGGAAAAGGGGGAGGGGGATGG + Intronic
914786507 1:150837235-150837257 CTGAAAAAGAGAGATGAGGTGGG - Intronic
915004974 1:152627412-152627434 AAGGAAGGGAGGGAAGAGGAAGG - Intergenic
915254653 1:154617240-154617262 GTGGCAATGAGGGATGAGGTAGG - Intronic
915463279 1:156082055-156082077 AGGGAAAAGAGGAGAGAGGAGGG + Intergenic
915739991 1:158111995-158112017 TTGGACATGAGGGGTGAGGAAGG - Intergenic
915875918 1:159612158-159612180 ATGAAAAAGATGGAGGAAGAGGG - Intergenic
915895404 1:159807949-159807971 AAGAGAAAGAGGGAAGAGGAAGG + Intronic
915910791 1:159914030-159914052 ATGGAAAGGAGAGTTGGGGAAGG - Intergenic
915939901 1:160112413-160112435 ATGAAAGAGAGAGAGGAGGAGGG - Intergenic
916005427 1:160655065-160655087 ATGGAGAAGAGGCAAGTGGATGG - Intergenic
916193080 1:162197937-162197959 ATGCAAAGGAGGTATGAGGAGGG + Intronic
916230162 1:162533821-162533843 AAAGAAAAGAGGGATCAGGCTGG + Intergenic
916271015 1:162941429-162941451 ATGAAAAAGCAGGATAAGGAAGG - Intergenic
916332159 1:163628692-163628714 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
916802943 1:168231611-168231633 AAGGAAAAGACAGAGGAGGAAGG - Intronic
917081637 1:171261826-171261848 AAGGAAAAGAGAGATAAGGCAGG + Intronic
917476214 1:175371552-175371574 ATGGAAAAGAATAATGACGAAGG + Intronic
917510705 1:175667094-175667116 GTGGTGAAGAAGGATGAGGAAGG - Intronic
917656026 1:177126530-177126552 ATGGAAAACAGGAAAAAGGAAGG + Intronic
917660822 1:177175276-177175298 ATGGAAAAGCGGGGTGGGGGGGG + Intronic
917794037 1:178520187-178520209 TTGGGGAAGGGGGATGAGGAAGG + Intronic
918687335 1:187434090-187434112 TGGGAAAAAAGGGTTGAGGAGGG + Intergenic
918925689 1:190782611-190782633 GGGGAGAAGATGGATGAGGAAGG - Intergenic
919233281 1:194804219-194804241 TTGGGAAAGGGGGATGAAGATGG - Intergenic
919241860 1:194924860-194924882 TTGGAGAAGAGGTATGTGGATGG + Intergenic
919266784 1:195278488-195278510 AAAGAAGAGAAGGATGAGGAAGG - Intergenic
919465973 1:197921805-197921827 AAGGGAGAGAGGGAGGAGGAGGG + Intronic
919469599 1:197961740-197961762 AAGAAAAAGAGGGATGAAGAAGG - Intergenic
919780834 1:201219823-201219845 ATGGAATGGAGGGATGGGGGAGG + Intronic
919923514 1:202180159-202180181 AAGCAGACGAGGGATGAGGAAGG + Intergenic
920057408 1:203202586-203202608 ATGGGAATGAGGAATGAGCAGGG - Intergenic
920365098 1:205444125-205444147 ATGGAAAAGGAGGGGGAGGATGG - Intronic
920371215 1:205480641-205480663 ACGGGAAAGAGGGATGAGGCTGG + Intergenic
920651262 1:207839046-207839068 ATAGAAAAGAGGCATATGGAAGG - Intergenic
920732892 1:208504575-208504597 CTGGAAATGAGGGTCGAGGAAGG + Intergenic
920817485 1:209348537-209348559 GTGGAAAAGAGGGATGAGGAAGG + Intergenic
920947065 1:210539526-210539548 CTGGTAAACAGGGATGAGGTGGG + Intronic
920966128 1:210702386-210702408 AAGGAAAAAGGGGAGGAGGAAGG - Intronic
921777503 1:219118666-219118688 AAGGGAAAGAGGGAAGAAGAAGG + Intergenic
921818371 1:219589387-219589409 ATGAAAAAGGGAGAGGAGGAGGG + Intergenic
921819115 1:219596437-219596459 CTGGAAAAGAGGAGTGAGAAGGG + Intergenic
921969339 1:221129203-221129225 ATGGGAAGGAAGGAGGAGGAGGG + Intergenic
922020705 1:221701289-221701311 TAGGGAAAGAGAGATGAGGAAGG - Intergenic
922022864 1:221721748-221721770 AGGGAAAAGAAGGCTCAGGAGGG + Intronic
922036800 1:221856686-221856708 ATGGGCAAGAGGGAGCAGGATGG - Intergenic
922724386 1:227915656-227915678 AAGGAGACGAGGGAAGAGGAAGG - Intergenic
923051374 1:230393254-230393276 AGGGAAAAGGGGGAGGAGGAGGG + Intronic
923092992 1:230753697-230753719 CTGGAAAAGTGGGAAGAGGTGGG + Intronic
923127776 1:231047368-231047390 AAGGAAAGGAGAGAGGAGGAAGG - Intergenic
923127794 1:231047441-231047463 AAGGAAAGGAGAGAGGAGGAAGG - Intergenic
923127812 1:231047514-231047536 AAGGAAAGGAGAGAGGAGGAAGG - Intergenic
923127830 1:231047587-231047609 AAGGAAAGGAGAGAGGAGGAAGG - Intergenic
923191363 1:231623698-231623720 GTGGATGAGAGGGATGAGTAAGG + Intronic
923532369 1:234821635-234821657 ATGGCACAGAAGAATGAGGATGG + Intergenic
923752537 1:236759518-236759540 ATGAAAAAGAGGGGAGAGGAGGG - Intronic
924073512 1:240308509-240308531 GCAGAAAAGAGGGACGAGGACGG + Intronic
924217572 1:241839849-241839871 CTGGAAAACAGGGCTGGGGAAGG - Intergenic
924268658 1:242309239-242309261 GCAGAAAAGCGGGATGAGGAAGG - Intronic
924307611 1:242707507-242707529 AGGGAAAAGACGGAGGAGGATGG - Intergenic
924400422 1:243674617-243674639 ACCCAAAAGAGGGGTGAGGAAGG + Intronic
924461466 1:244263359-244263381 AAGGAAGAGAGGGAGGAGGGAGG + Intergenic
924832067 1:247606710-247606732 ATTGAAAAGAGAGCTGTGGATGG + Intergenic
1062966043 10:1608585-1608607 AAGGAAAAAAGGAATGAGGAAGG + Intronic
1063153392 10:3356456-3356478 AAGGAAGAGAGGGAGGGGGAGGG - Intergenic
1063225684 10:4013182-4013204 GAGGAAAAGGGGGATGAGGAGGG - Intergenic
1063877157 10:10492253-10492275 ATGGAAAAGAGGGGCAAGGCTGG - Intergenic
1064008301 10:11715152-11715174 GAGGGAAAGAGGGAGGAGGAAGG + Intergenic
1064371375 10:14754500-14754522 CTGGAAGAGAGAGATGAGCAGGG - Intronic
1064443601 10:15373996-15374018 GTGGAAAAGAGGGATGAGGAAGG + Intergenic
1064462799 10:15551253-15551275 ATGGATGAGAGAGAAGAGGAGGG + Intronic
1064504567 10:16014757-16014779 ATGCAAAGGAGGGAGGATGATGG + Intergenic
1064577471 10:16760825-16760847 ATGGAGAAGAGGGTGGAGGGAGG - Intronic
1064731516 10:18335908-18335930 TTTGAAGAGAAGGATGAGGATGG - Intronic
1065272091 10:24044561-24044583 ATGGAAAAGAGGTGAAAGGAAGG - Intronic
1065511772 10:26486402-26486424 ATGGAAAAATGGGAGGAGTAAGG + Intronic
1065795041 10:29298843-29298865 ATGAACCAGAGGGAGGAGGATGG + Intronic
1065867672 10:29927956-29927978 ATAGAAAAGAGGGATGATCAGGG + Intergenic
1065933460 10:30499858-30499880 AGGGAAGAGAGGGAGGAGGTAGG + Intergenic
1065933527 10:30500112-30500134 AAGGAAGGGAGGGATGGGGAGGG + Intergenic
1066008568 10:31171070-31171092 GTGGAAAAGAGGGACGAGGAAGG - Intergenic
1066277659 10:33884722-33884744 ATGGAGAAGAGAGAAGTGGATGG - Intergenic
1066415080 10:35214266-35214288 AGGGAAAAGAATGAGGAGGAAGG - Intergenic
1066638960 10:37536467-37536489 GCAGAAAAGACGGATGAGGAAGG + Intergenic
1066716248 10:38289529-38289551 GCAGAAAAGTGGGATGAGGAAGG + Intergenic
1067083823 10:43227921-43227943 ATGGCAGAGAAGGAGGAGGAGGG - Intronic
1067314704 10:45150888-45150910 TTGGAAGAGAGGGTTGATGAGGG - Intergenic
1067475749 10:46564817-46564839 ACGGAAAAGGCGGAAGAGGAGGG - Intergenic
1067488897 10:46679238-46679260 GTGGAAAGGAGGGATGAGGAAGG - Intergenic
1067507750 10:46871143-46871165 ATGGAAAACAGAGAACAGGAAGG - Intergenic
1067533321 10:47090440-47090462 ATGGAAGATGGGGCTGAGGAAGG - Intergenic
1067605771 10:47661138-47661160 GTGGAAAGGAGGGATGAGGAAGG + Intergenic
1067618988 10:47776958-47776980 ACGGAAAAGGCGGAAGAGGAAGG + Intergenic
1067654503 10:48180702-48180724 ATGGAAAACAGAGAACAGGAAGG + Intronic
1067859224 10:49827496-49827518 GCGGAAAAGAGGGATGAGGAAGG - Intronic
1068033189 10:51728717-51728739 ATGGAATAGAATGATGAGAAAGG + Intronic
1068595103 10:58894802-58894824 GAGTAAAAGAGGGAGGAGGATGG + Intergenic
1069093949 10:64235727-64235749 ATAGAAAAGAGTGATGAAGAAGG + Intergenic
1069180891 10:65357211-65357233 GCAGAAAAGAGGGATGAGGAAGG - Intergenic
1069204947 10:65669754-65669776 ATAGAAAATAGGGAAGAGGGAGG + Intergenic
1069569789 10:69487374-69487396 ATAGAAAAGAGGGACAGGGAGGG - Intronic
1069640870 10:69954754-69954776 ATGAAAGAAAGGGACGAGGAAGG - Intronic
1069718510 10:70535551-70535573 AAGGAAGAGAAGGAGGAGGAAGG - Intronic
1069755977 10:70774653-70774675 AAGGAGAAGGGGGAGGAGGAAGG - Intronic
1070330101 10:75410266-75410288 AAGGAAAGAAGGGATGAGGATGG - Intergenic
1070421722 10:76243989-76244011 ATGGAGAAGAGATATGAAGATGG + Intronic
1070661228 10:78306780-78306802 GTGGAAAAGAGGGTGAAGGAAGG + Intergenic
1070754654 10:78984530-78984552 ATAGAAAGCAGGGATGGGGAAGG + Intergenic
1071093286 10:81945270-81945292 AGGAAAAAGAAGGAGGAGGAAGG - Intronic
1071284809 10:84134572-84134594 ATGGGAGAGAGAGAAGAGGAGGG + Intergenic
1071541812 10:86492025-86492047 GTGGATACCAGGGATGAGGAGGG - Intronic
1071561808 10:86651303-86651325 ATGGAAAAGGGGTAGGAGCAAGG + Intergenic
1071621330 10:87122497-87122519 GTGGAAAGGAGGGATGAGGAAGG + Intronic
1071868860 10:89769332-89769354 GCAGAAAACAGGGATGAGGAAGG - Intronic
1071896517 10:90073895-90073917 ATTGAAAAGTGGGGTGAAGAAGG - Intergenic
1071934081 10:90507310-90507332 GTGGAAAAGAGGCATGAGGAAGG + Intergenic
1072009147 10:91288286-91288308 AAGGTAAAGAGGGAAGAAGAGGG - Intergenic
1072085657 10:92076876-92076898 AGGGAAAGGAAGGAAGAGGAAGG + Intronic
1072215697 10:93285584-93285606 ATGGCAAGGAGGGCAGAGGAGGG + Intergenic
1072433370 10:95393536-95393558 CTGGAAAACAGCGATGATGAAGG - Intronic
1072688250 10:97551706-97551728 ATGGAAAAGTGGGAAGAGTTTGG - Intronic
1072711830 10:97720793-97720815 AAAGAAAAGAGAGATTAGGATGG - Intergenic
1072830451 10:98652246-98652268 AAGGAAAATAGGGAATAGGAAGG + Intronic
1072902332 10:99419533-99419555 ATGGAAGAGGGGCAAGAGGAAGG - Intronic
1073027057 10:100495749-100495771 GTGGAAAACCGGGATGAGGAAGG + Intronic
1073852322 10:107635206-107635228 AGGGAAAACAGGGGTGAGGATGG - Intergenic
1073918387 10:108431672-108431694 TTGGAGAAGAGGTATGTGGATGG - Intergenic
1074081264 10:110169836-110169858 AGGGAGAAGGGAGATGAGGAGGG - Intergenic
1074145935 10:110717344-110717366 CTGGAGAGGAGGGAGGAGGAGGG - Intronic
1074260987 10:111853064-111853086 ATGGAAAATAGCTAGGAGGAAGG - Intergenic
1074495614 10:113977837-113977859 ATGGGAAAGAGGAGTGAGGTGGG - Intergenic
1074800386 10:116994517-116994539 AGGGGAAAGAGGGAAGGGGAAGG + Intronic
1074827961 10:117228367-117228389 AAGGAAGAGAGGGAGGAAGAGGG - Intergenic
1074908543 10:117886404-117886426 ATGCAAAAGTGGGATGAGCCAGG - Intergenic
1074998842 10:118780182-118780204 AAGGAATGGAGGGAGGAGGAAGG - Intergenic
1075075742 10:119349153-119349175 CTGGAGAAGAGGCAGGAGGAAGG + Intronic
1075083781 10:119400744-119400766 AGGAATAAGGGGGATGAGGAAGG + Intronic
1075126029 10:119699733-119699755 GTGGAAAAGAGGGAACAGGTTGG - Intergenic
1075149098 10:119910643-119910665 ATGGAGAGGAGAAATGAGGAAGG - Intronic
1075562450 10:123478169-123478191 ATGGAAAAGAGGAACGAGTTAGG + Intergenic
1076015838 10:127027156-127027178 AAGGAAAAGAGTGGTGTGGAGGG + Intronic
1076109410 10:127849448-127849470 ACGGACAAGGGGCATGAGGAGGG + Intergenic
1076161348 10:128246547-128246569 AAGGAAGAGAGGGAGGAGGATGG - Intergenic
1076348002 10:129793854-129793876 AAGGAAAAGAGGAAGGAAGAGGG - Intergenic
1076856019 10:133115981-133116003 AGGGAAAAGAGGGAGGGAGAAGG - Intronic
1077009862 11:375031-375053 GTGGAAGGGAGGGAGGAGGAAGG + Intronic
1077009874 11:375061-375083 GTGGAAGGGAGGGAGGAGGAAGG + Intronic
1077009886 11:375091-375113 GTGGAAGGGAGGGAGGAGGAAGG + Intronic
1077009916 11:375166-375188 GTGGAAGGGAGGGAGGAGGAAGG + Intronic
1077282577 11:1752356-1752378 CGGGACAAGAGGGCTGAGGAGGG + Intronic
1077385106 11:2265723-2265745 GCAGAAAAGAGGGATGAGGAAGG - Intergenic
1078373729 11:10774866-10774888 TTGGGAAAGAAGGAAGAGGAAGG + Intronic
1078442253 11:11377788-11377810 GAGGAAAAGACAGATGAGGATGG + Intronic
1078721652 11:13890044-13890066 CTGGCAAAGAGGGAAGAGAAGGG - Intergenic
1078727877 11:13948046-13948068 ATGGAAAAGAGGGATGAGGAAGG - Intergenic
1078916240 11:15781409-15781431 AAGGAAAAGAGAGACCAGGAAGG - Intergenic
1079429358 11:20374119-20374141 ATGGGAAAGGAGGATGAGGAAGG + Intronic
1079455982 11:20636633-20636655 ATAGAACAGAGGGAGAAGGAAGG - Intronic
1079868715 11:25768099-25768121 AAGGAAAAGAGGGAGGATGGAGG + Intergenic
1079944843 11:26729237-26729259 GTGGAAAAGAAGGATGAGGAAGG - Intergenic
1080876602 11:36280286-36280308 GTGGGACAGAGGGGTGAGGAGGG + Intronic
1080895766 11:36447833-36447855 ATGGAAGAGATGGAGAAGGAGGG + Intronic
1080941598 11:36924439-36924461 ATTAACAAGAGGAATGAGGAAGG + Intergenic
1081209096 11:40309872-40309894 AAGGAAAGGATGGTTGAGGAGGG + Intronic
1081310156 11:41560859-41560881 ATTTAAAAGAGAGATGAGGCTGG - Intergenic
1081575210 11:44314879-44314901 AAGGAAAAGAGAGAGAAGGAAGG - Intergenic
1081590877 11:44422263-44422285 ATGTCAAAAAGGGAGGAGGAGGG + Intergenic
1081690211 11:45072882-45072904 AGGCTAGAGAGGGATGAGGAAGG + Intergenic
1081705091 11:45178220-45178242 AGGGCACAGAGGGATGCGGAAGG - Intronic
1082671779 11:56043675-56043697 ATGGGGAAGAGGTATGTGGATGG + Intergenic
1082680799 11:56166550-56166572 AAGGAAAAGATGGATGAGAAGGG - Intergenic
1082796325 11:57380610-57380632 AAGGGAAAGACGCATGAGGAGGG + Intronic
1082862841 11:57872134-57872156 GTGGAAGAGAGGGATTGGGAAGG - Intergenic
1083225672 11:61282969-61282991 ATGGAGATGAGGGAGGAAGAGGG - Intronic
1083254427 11:61487427-61487449 GTGGAGAAGAGGGATGAGGGAGG + Intronic
1083588549 11:63878254-63878276 ATGGAGATGAGGAATGAGGCTGG - Intronic
1084443851 11:69192011-69192033 GTGGCAAACTGGGATGAGGATGG + Intergenic
1084635491 11:70389647-70389669 GTAGAAAAGAGGGATAAGGAAGG - Intergenic
1084723888 11:70927851-70927873 ATAGAACAAAGGGAAGAGGAAGG + Intronic
1085282649 11:75341053-75341075 ATGGAAAAGAGGGATGAAAGAGG + Intronic
1085502660 11:77037978-77038000 AGGGGGAAGAGGGAGGAGGAGGG + Intronic
1086074244 11:82833362-82833384 ATGGAAAAAGAGGATGAGAAAGG + Intronic
1086109729 11:83186947-83186969 ATGGAGAAGAGGGTCAAGGATGG + Exonic
1086348603 11:85922731-85922753 ATGGAGAAGAGTGATGAGAAGGG - Intergenic
1086520863 11:87666322-87666344 ATGAAAAAGAGGGAAGGGAAAGG - Intergenic
1086586293 11:88456293-88456315 ATGATGAAGAGGGAAGAGGAGGG - Intergenic
1087175594 11:95092292-95092314 ATGGAAGGGAGGGATCAGGTGGG + Intronic
1087229340 11:95642156-95642178 AAGGAAGAGAGAGAGGAGGAAGG + Intergenic
1087610776 11:100431898-100431920 AAGCAAAAGTGGGATGAGGGAGG + Intergenic
1087899003 11:103619406-103619428 AAGGAAAAAAGGGAGGAGTAGGG + Intergenic
1088183201 11:107135341-107135363 GTGGAAAAGAGGGATGAGGAAGG - Intergenic
1088442666 11:109889010-109889032 AAGGAAAAGAGGGGTAAGGAGGG - Intergenic
1088443684 11:109900790-109900812 AAGGAAAAGAGAGGAGAGGAGGG + Intergenic
1088807453 11:113365405-113365427 AGAGAAAAGAGGGAAGAGAAGGG - Intronic
1089231405 11:116980332-116980354 GCGGAAAAGAGGGTTGAGGAAGG - Intronic
1089712589 11:120326175-120326197 AAAGAAAAGAAGGAAGAGGAAGG - Intronic
1089714517 11:120345172-120345194 AACGGAAAGAGGGATGAGGAAGG + Intronic
1089743413 11:120600516-120600538 TTTGAACAGAGGGCTGAGGAGGG + Intronic
1089769378 11:120792300-120792322 AAGGTAGAGAGGGATGAGCAGGG + Intronic
1090119112 11:124005762-124005784 TTGGAGAAGAGGTATGTGGATGG - Intergenic
1090217664 11:124984216-124984238 CTGGAAAAGTGGCATGAGGGAGG + Intronic
1090502971 11:127279729-127279751 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
1090510632 11:127371065-127371087 ATGGAGAAGAGAGATGAGAAAGG - Intergenic
1090746288 11:129707730-129707752 GCGGAAAAGTGGGATGAGGAAGG + Intergenic
1090996069 11:131866981-131867003 ATGGAGAACAGGGAGGAGGTGGG + Intronic
1091337223 11:134781514-134781536 GTGGAAAAGAGGAAAGAAGAGGG - Intergenic
1091356111 11:134938853-134938875 GTGGAAAAGAGGGATGAGGAAGG - Intergenic
1091413506 12:259970-259992 ATGGAAAAGAAGGAGGAAGATGG - Exonic
1091427758 12:406241-406263 ACAGAGAAGAGGGATGAGGTTGG + Intronic
1091957170 12:4655768-4655790 AGGGGAAAGAGGGTAGAGGAGGG + Intronic
1091978443 12:4845838-4845860 ATGCAAGATAGGGATGAGGAAGG - Intronic
1091991255 12:4957831-4957853 AAGGAAAGGAGGGAAGAGGAAGG - Intergenic
1092266318 12:6983469-6983491 ATGGAAGAGGTGGATGAGGTAGG + Exonic
1092312531 12:7374025-7374047 AGAGGAAAGAGGGATGAGGAAGG - Intronic
1092396081 12:8128082-8128104 ATGAGAAAGACGGATAAGGATGG + Intronic
1092611010 12:10173428-10173450 ATAGGAAACAGGGAGGAGGAGGG - Intronic
1092736783 12:11590266-11590288 ATGGGAGAGAAGAATGAGGATGG + Intergenic
1092817311 12:12323074-12323096 AAGGAAGGGAGGGAGGAGGAGGG + Intergenic
1092931479 12:13319912-13319934 ATGGAAAGAAAGGAGGAGGAAGG + Intergenic
1092944737 12:13442195-13442217 CAGGGAAAGAGAGATGAGGAGGG - Intergenic
1093147079 12:15579475-15579497 ATGGAAAAGTGAGAAGAGAAAGG + Intronic
1093426822 12:19037112-19037134 CTGGAAAACAGGAATTAGGAAGG + Intergenic
1093548933 12:20383751-20383773 ATGGAAAAAGGTGAGGAGGAGGG + Intronic
1093551162 12:20413419-20413441 GTGGAAAAGTGGGCTGAGGAAGG + Intronic
1093652333 12:21659550-21659572 ATGGAAATGAGGGTAGAGGAGGG - Intronic
1093702372 12:22236503-22236525 TTTAAAAAGAGGGCTGAGGAGGG + Intronic
1093725909 12:22508339-22508361 AGGGAAAATAAGGAAGAGGATGG + Intronic
1093865797 12:24226220-24226242 ATGAATAAAAGGGATGGGGATGG - Intergenic
1094038783 12:26101068-26101090 ATGGAAAAGAGATATGATCATGG - Intergenic
1094183455 12:27616114-27616136 AGGGAAAAGAGGAGGGAGGAAGG - Intronic
1094471789 12:30808551-30808573 ATTGAAGAGAGAGTTGAGGAAGG + Intergenic
1095500226 12:42829618-42829640 ATGGAAAAGAGAGAAAAGCAGGG - Intergenic
1095791962 12:46177230-46177252 ATGGAAAACAGGGCTGGGGCTGG + Intergenic
1095998365 12:48108362-48108384 AAGAGAAAGAGGGATGGGGAGGG + Intronic
1096019823 12:48314343-48314365 ATGGAAAACTGGGATGGTGACGG - Intergenic
1096576248 12:52554609-52554631 ATGGATGGGAGGGATGAGGAGGG - Intergenic
1096621584 12:52868966-52868988 AGTGAAAGAAGGGATGAGGAGGG + Intergenic
1096814857 12:54195703-54195725 AAGAAAGAGAAGGATGAGGAAGG - Intergenic
1096841646 12:54383512-54383534 AGGGAACAGAGGCAGGAGGAAGG - Intronic
1097124242 12:56760809-56760831 TTGGACATGGGGGATGAGGAAGG + Intronic
1097475319 12:60047959-60047981 ATGGAAAAAGGCGAAGAGGAAGG - Intergenic
1097517182 12:60620065-60620087 ATGGAAAACATGGAGGGGGAAGG + Intergenic
1097677113 12:62614801-62614823 AAGAAAAAGAAGGAAGAGGAAGG - Intergenic
1097780463 12:63697330-63697352 ATGGAAGATAGGTGTGAGGATGG + Intergenic
1097788568 12:63789027-63789049 GCAGAAAAGAGGGATAAGGAAGG + Intronic
1097825645 12:64172448-64172470 AAGGAAAAGAGGAGGGAGGAGGG + Intergenic
1098084092 12:66822822-66822844 ATGGAAACGGGGGAGGAGAAAGG + Intergenic
1098167785 12:67715812-67715834 ATGGCAAAGAGGGAAGAGGGAGG + Intergenic
1098203136 12:68078498-68078520 GCGAAAAAGAGGGAGGAGGAAGG - Intergenic
1098239172 12:68448874-68448896 GCAGAAAAGAGGGATGAGGAAGG + Intergenic
1098290254 12:68951417-68951439 AAGGAAAAGAAGGAGTAGGATGG + Intronic
1098353915 12:69591797-69591819 GCAGAAAAGAGGGAGGAGGAAGG - Intronic
1098707793 12:73713329-73713351 AGGGAAAAATGGGAAGAGGAAGG - Intergenic
1098727452 12:73986241-73986263 ATATAAAGGAGGGATGATGAGGG - Intergenic
1098831817 12:75373397-75373419 TTGGAGAAGAGGTATGTGGATGG - Intronic
1098910765 12:76205955-76205977 AGGGAAAAGAGAGAGGAGAAAGG + Intergenic
1099174958 12:79410433-79410455 GTGGAAAAGAGAGATGAGGAAGG - Intronic
1099398439 12:82170982-82171004 AAGAAAAAGAAGGAGGAGGAGGG + Intergenic
1099508652 12:83507820-83507842 CTGGGAAAGAGGTATGTGGAGGG + Intergenic
1099735871 12:86565669-86565691 TTGGGGAAGAGGGATGTGGATGG + Intronic
1099813130 12:87610860-87610882 ATGGAAGGGAGGGTGGAGGATGG + Intergenic
1099913929 12:88868169-88868191 ATGGAAAATAAGGATTAAGATGG + Intergenic
1099959192 12:89380439-89380461 ATGGGAAGGAGGGAAGAGGGAGG - Intergenic
1100372472 12:93980865-93980887 AGGGGAAAAAGGGAGGAGGAAGG + Intergenic
1100602061 12:96120655-96120677 AAGAAAAAGATGGAAGAGGAGGG + Intergenic
1100690288 12:97032264-97032286 ATGGTAAAGTGGGAAGAGAAAGG + Intergenic
1100803255 12:98255224-98255246 ATGGTAAAAATTGATGAGGAGGG - Intergenic
1101124324 12:101615349-101615371 AGGAGGAAGAGGGATGAGGAAGG - Intronic
1101255578 12:102973722-102973744 AAGGGAAAGAGGGAGGGGGAAGG - Intergenic
1103058891 12:117842982-117843004 TTGGGAAGGAGGGAGGAGGAAGG + Intronic
1103098237 12:118149116-118149138 ATGGAAAAGGGGGACGAGGAAGG - Intergenic
1103126057 12:118423489-118423511 ATGAAAATGAGGCTTGAGGAGGG + Intergenic
1103245481 12:119453300-119453322 ATGGAAGAAAAGGAGGAGGAGGG - Intronic
1103430824 12:120884202-120884224 AGGGGACAGAGGCATGAGGAAGG + Intronic
1104178815 12:126357952-126357974 GGGGAAGAGAGGGAAGAGGAGGG + Intergenic
1104485241 12:129145876-129145898 GTGGAAAAGAGAGATGAGGAAGG - Intronic
1104672932 12:130692798-130692820 ATGGAAAAGTGGGATGGGATGGG + Intronic
1104744178 12:131200841-131200863 AAGGAATAGTGGGATGAAGATGG - Intergenic
1104790201 12:131476382-131476404 AAGGAATAGTGGGATGAAGATGG + Intergenic
1104791315 12:131483783-131483805 ATGGAAACCAGGGATGGGGAGGG + Intergenic
1105402137 13:20105215-20105237 ATGGGAAGGAGGGAAGAGGCTGG + Intergenic
1105722873 13:23134511-23134533 CTGGAAAAGGAGGAAGAGGAGGG + Intergenic
1106497867 13:30297163-30297185 AAAGAAAAGAAGGAGGAGGAAGG + Intronic
1106582027 13:31027088-31027110 CTGGAGAAGAAGGAGGAGGAGGG - Intergenic
1106840252 13:33679093-33679115 ATGAAAAAAAGGCATGAGAAAGG + Intergenic
1106900718 13:34352261-34352283 GTGAAAAAGAGGGATGAGGAAGG - Intergenic
1107070275 13:36261019-36261041 CTGGGAAAGAGGTATGTGGATGG + Intronic
1107571442 13:41663306-41663328 ATGGAAAAGAGGAATGAGGGTGG - Intronic
1107716983 13:43210017-43210039 AGGGACTAGAGGGATGAGTAAGG + Intergenic
1107731057 13:43349497-43349519 GTGGAAGAGAGGGAGAAGGAAGG - Intronic
1107855363 13:44610325-44610347 ATGAGAGAGAGGGAAGAGGAAGG + Intergenic
1107983490 13:45755330-45755352 TTGGTAAAGAGGTATGTGGATGG - Intergenic
1107996185 13:45863427-45863449 ATTGCAAAGAGAGATGGGGAGGG + Intergenic
1108260019 13:48646810-48646832 TTGGAAAATAGGCATGAGGAAGG - Intergenic
1108443209 13:50477527-50477549 ATGGAAATGAGGAAAGGGGAAGG + Intronic
1108523817 13:51268283-51268305 ATGGAAAGGAGTAATGAGAACGG + Intronic
1108592445 13:51923659-51923681 ATGGAAAAAAAGGAAGATGAAGG + Intergenic
1108711287 13:53035002-53035024 AAGGAAAAGAGAGATTAGAAGGG - Intronic
1108841852 13:54627727-54627749 AGGATAAAGAGGGATGAGGAGGG + Intergenic
1109384705 13:61611163-61611185 AAGGAAAAGAGGAAGGAGGCAGG - Intergenic
1109589672 13:64462169-64462191 TTGAAAAAGAGGGGTTAGGATGG - Intergenic
1110192382 13:72745333-72745355 GTGGAAAAGAGGGATGAGGAAGG + Intronic
1110241693 13:73274645-73274667 AAGGAAAAGAGAGAAAAGGAAGG + Intergenic
1110369195 13:74720716-74720738 ATGGAAAAGAGAGGTCAGGAAGG - Intergenic
1111096223 13:83518544-83518566 ATGGAAAAGAAAAATGAGGAGGG + Intergenic
1111223985 13:85245198-85245220 ATGGAAAAAAGGGAAAAGTATGG + Intergenic
1111792021 13:92869541-92869563 AAGGAAAGGAGGGAGGAGGGAGG + Intronic
1112386079 13:98940842-98940864 ATAGATAAGAGGGATGATGGAGG - Intronic
1112460845 13:99602550-99602572 ATGGGAAAGAAGGATGGGGCGGG - Intergenic
1112834623 13:103499004-103499026 AAGGAAAAGAGGGAAGCAGAAGG - Intergenic
1113166272 13:107447149-107447171 AAGGAGAAGAGGAAGGAGGAAGG - Intronic
1113215902 13:108040296-108040318 TGGGAAAAGAGGGGTGAGGTTGG - Intergenic
1113749100 13:112766312-112766334 AAGCAGAAGAGGGATGAGTAAGG + Intronic
1114353515 14:21881427-21881449 AAGGAAAAAAGGAAAGAGGAGGG - Intergenic
1114642834 14:24235844-24235866 CTGGAAAACTGGGATAAGGAAGG - Intronic
1114672605 14:24419583-24419605 ATGAAAACGAGTGATGAGGCAGG + Intergenic
1115106108 14:29763451-29763473 GTGGAAAGGAGGGAAGGGGAGGG + Intronic
1115320420 14:32075154-32075176 GTGGGAAAGAAGGATGCGGAAGG - Intergenic
1115364145 14:32537468-32537490 ATGGAGATCAGAGATGAGGAAGG + Intronic
1115419385 14:33176368-33176390 AGGGAAAGGAGGGATAAGCAGGG - Intronic
1115702868 14:35972324-35972346 AAGGAAGGGAGGGAGGAGGAGGG - Intergenic
1116023208 14:39486011-39486033 CTGGAAAAGGGGCATGAGAATGG - Intergenic
1116255291 14:42547489-42547511 ATGGACAAGAGAGAGGCGGAAGG + Intergenic
1116347566 14:43814410-43814432 ATGGATAAGAGGGTTGTAGAAGG + Intergenic
1116414780 14:44667021-44667043 CTGGAGAAGAGGCATGAGAATGG + Intergenic
1116531374 14:45977607-45977629 TTGGAGAAGAGGCATGTGGATGG - Intergenic
1117255748 14:53975754-53975776 ATGAAAAAGAGGCCAGAGGAGGG - Intergenic
1117943694 14:60995606-60995628 AAGGAAGAAAGGGAGGAGGAAGG + Intronic
1118249661 14:64147295-64147317 AAGGAAATGAGGGAGGAGGCTGG - Intronic
1118451564 14:65907133-65907155 AAGGAAAAGAGGGAAGGAGAAGG + Intergenic
1118574159 14:67224770-67224792 ATGGAAAAGAAAGATGGGTAAGG - Intronic
1118866723 14:69710213-69710235 ATGGAAGAGGAGGAAGAGGAGGG - Intronic
1118872006 14:69750889-69750911 GCAGAAAAGAGGGATGAGGAAGG - Intronic
1118880689 14:69823388-69823410 TTGGGAAAGAGGTATGTGGACGG - Intergenic
1119186176 14:72644042-72644064 ATGGAAAATGAGGATGATGATGG + Intronic
1119632727 14:76247979-76248001 ATAGGATAGAGGCATGAGGAAGG + Intronic
1119639961 14:76307492-76307514 TTGAAAAGGAGGGATTAGGAAGG + Intergenic
1119863413 14:77953691-77953713 ATGGAAACAGGGCATGAGGAAGG - Intergenic
1121074977 14:91060421-91060443 AAGGAGAAGATGGAGGAGGAGGG - Exonic
1121141357 14:91545271-91545293 ATGGAAAAGAGAGAGAAAGAAGG - Intergenic
1121430194 14:93880962-93880984 ATGATCAAGAGGGATGAGGTTGG - Intergenic
1121546688 14:94768519-94768541 CCGGAGAAGAGGGAAGAGGAAGG - Exonic
1121777056 14:96598081-96598103 AGGGAGAAGGGGGAAGAGGAGGG - Intergenic
1121920041 14:97872164-97872186 ATGGAACAGTGGGCTAAGGAAGG + Intergenic
1122068586 14:99190599-99190621 AAGGGAAGGAGGGAAGAGGAAGG + Intronic
1122082414 14:99274709-99274731 GAGGAAAAGGGGGAGGAGGAGGG - Intergenic
1122801273 14:104230824-104230846 ATGGAGATGAGGCCTGAGGAGGG + Intergenic
1124231151 15:27947422-27947444 ATGGCAAAGAAGGGTGAGCAAGG - Intronic
1124861425 15:33445613-33445635 GTAGAAAAATGGGATGAGGAGGG - Intronic
1124953652 15:34345815-34345837 AGGGAAAAGTGGGGTGAGGGTGG - Intronic
1125426812 15:39556981-39557003 ATGGAAAAGAGGGATGAGGAAGG - Intergenic
1126296936 15:47149857-47149879 AGGGGAAAGAGAGATGAAGAGGG + Intergenic
1126804977 15:52339090-52339112 ATGGGAATGAGGGAGGAGGGTGG - Intronic
1126917794 15:53484736-53484758 GCAGAAAAGAGGGATGAGGAAGG - Intergenic
1127151282 15:56078130-56078152 GAAGAAAAGTGGGATGAGGAGGG - Intergenic
1127363369 15:58264663-58264685 AGGGAGAAGAGGGAGAAGGAGGG - Intronic
1127407934 15:58672481-58672503 ATGGCAAAGGGGGACAAGGATGG + Intronic
1128252239 15:66171526-66171548 ATGGAGAGGTGGGAGGAGGAGGG + Intronic
1128325784 15:66723149-66723171 ATGGAACAAAGTCATGAGGAGGG + Intronic
1128355689 15:66925001-66925023 ATGGAAAAGAGGCGTGTGGGAGG + Intergenic
1128532381 15:68463336-68463358 GAGGAGATGAGGGATGAGGAAGG + Intergenic
1128732530 15:70030904-70030926 ACAGAAAGGAGGGAGGAGGAAGG - Intergenic
1128733294 15:70035075-70035097 AAGGATGAGGGGGATGAGGAAGG - Intergenic
1128754568 15:70172611-70172633 ATGGAAAAAATGGAGGAAGAAGG + Intergenic
1129820381 15:78597499-78597521 GAGGGAAAGAGTGATGAGGATGG - Intronic
1129862080 15:78870941-78870963 GTGGAAAAGGGGGATGAGGAAGG - Intronic
1129929855 15:79401738-79401760 ATGGAAAAGAGAAACGAGGGTGG + Intronic
1130120675 15:81045040-81045062 AAGGGAAAGAGGGAGAAGGAAGG - Intronic
1130225995 15:82058823-82058845 AGGGAGGAGAGGGAAGAGGAGGG - Intergenic
1130789481 15:87137544-87137566 ATGGAAAAGAGTAAAGAGGATGG + Intergenic
1130948861 15:88570018-88570040 CTGGAATATAAGGATGAGGAAGG + Intergenic
1130961280 15:88660061-88660083 ATGGAATAGGAGAATGAGGAGGG - Intergenic
1131121269 15:89824572-89824594 CAGTAAAAGAGGGCTGAGGACGG + Intergenic
1131253135 15:90844069-90844091 ATGGGAAGGAGGGAGGAGGGAGG - Intergenic
1131312606 15:91304566-91304588 GAGAAAAAGAGGGAGGAGGAAGG + Intergenic
1131341939 15:91610724-91610746 ATGGGAACCAGGGAAGAGGATGG + Intergenic
1131651929 15:94409714-94409736 ATGGAGAAGAGGGAAGAGAGAGG - Intronic
1131736616 15:95339398-95339420 ATGGAAAAGAGGGAGGGGGAAGG + Intergenic
1131937771 15:97525742-97525764 ATGGAAAAAAGGAAAGAAGAAGG + Intergenic
1131957044 15:97747983-97748005 AGGGAAGAGAGGGAGGAGGCAGG + Intergenic
1132903548 16:2271019-2271041 CTGGGACACAGGGATGAGGATGG + Intergenic
1133529557 16:6641922-6641944 ATGGAAAAAAGAGAAGAGGCTGG - Intronic
1134031432 16:10995541-10995563 ATGGAAGAGAGGGCAGGGGAGGG - Intronic
1134071952 16:11265758-11265780 TTGCGAAAGAGGAATGAGGAAGG + Intronic
1134092264 16:11397895-11397917 ATGGAAGATAGGAAGGAGGATGG + Intronic
1134297570 16:12960772-12960794 TTGGAGAGGAGGGAAGAGGACGG - Intronic
1134332643 16:13265065-13265087 AAAGAAGGGAGGGATGAGGAGGG - Intergenic
1134394951 16:13854208-13854230 AAGAAAAAGAGGGATGGGGGAGG + Intergenic
1134562875 16:15225900-15225922 AAGGAAGAGAGAGAAGAGGAAGG + Intergenic
1134687596 16:16169609-16169631 TGGGAGGAGAGGGATGAGGAGGG + Intronic
1134754061 16:16650745-16650767 AGGGAAGGGAGGGAAGAGGAGGG - Intergenic
1134754094 16:16650830-16650852 ATGGAAGAGAGGGAAGAGAAGGG - Intergenic
1134814009 16:17191107-17191129 GCAGAAAAGAGGGATGAGGAAGG + Intronic
1134923412 16:18137533-18137555 AAGGAAGAGAGAGAAGAGGAAGG + Intergenic
1134991967 16:18708219-18708241 ATGGAAGAGAGGGAAGAGAAGGG + Intergenic
1134991998 16:18708299-18708321 AGGGAAGGGAGGGAAGAGGAGGG + Intergenic
1135002342 16:18787310-18787332 ATGGAAAAGAGGGATGAGGAAGG - Intronic
1135061805 16:19277411-19277433 AGGGAAAAGAGGGGGCAGGAGGG + Intergenic
1135092085 16:19524985-19525007 CTGTAAAAGAGGGATGATCACGG - Intronic
1135282595 16:21165563-21165585 ATGGCAGAGAGGGAAGAGAAGGG - Intronic
1135829018 16:25756726-25756748 CTGGCACAGAGAGATGAGGAAGG + Intronic
1136081342 16:27854319-27854341 AAGGAAAAGGGGGAGGAGGAGGG + Intronic
1136539109 16:30918756-30918778 AAGAAGAAGAGGGAGGAGGAAGG - Intergenic
1136589034 16:31206188-31206210 AAGGAAAGGAGGGGGGAGGAAGG - Intergenic
1137378903 16:47979490-47979512 TTGTAAAAGAGGCAGGAGGAGGG - Intergenic
1137483408 16:48871332-48871354 CTGGAGAAGAGGAAAGAGGAAGG + Intergenic
1137960561 16:52877946-52877968 ATAGAAATGAGGGATGAGGGTGG - Intergenic
1138136390 16:54526945-54526967 TTGGAAAAGAGAGCTGAAGAAGG - Intergenic
1138499816 16:57433498-57433520 AGGGATAGGAAGGATGAGGATGG + Intronic
1138535015 16:57655228-57655250 AGGGAAGGGAGGGATGAGGAGGG + Intronic
1139042000 16:63009047-63009069 ATAGAAAAGAAGAATTAGGAAGG + Intergenic
1139387912 16:66586098-66586120 ATGGGCAGGAGGGTTGAGGAAGG + Intronic
1139490437 16:67283163-67283185 AGGCAGAAGAGGGTTGAGGATGG + Intronic
1139532968 16:67552483-67552505 ATGGAACAGAAGCCTGAGGAGGG + Intergenic
1139629180 16:68217768-68217790 ATGGGAAAAAGGGAGGAAGAAGG + Intronic
1139760354 16:69180086-69180108 AGGGAAAAGAAGAAAGAGGAAGG - Intronic
1140063744 16:71592543-71592565 ATGGAGAGGAGGGAGGAGAAAGG - Intergenic
1140195090 16:72848800-72848822 AAGGGAAAGAGGGAGGAAGAAGG - Intronic
1140489380 16:75321619-75321641 GCGGAAAAGAGGGGTGAGGAAGG + Intronic
1140894361 16:79311940-79311962 ATGGCGGAGAGGGAAGAGGAGGG + Intergenic
1140965986 16:79966515-79966537 AAGGAAAGGAAGGTTGAGGAAGG - Intergenic
1141211711 16:81987130-81987152 CTGGAAATGAGGGAGGAAGATGG - Intergenic
1141230951 16:82167247-82167269 AAGAAAAAGAAGGATGTGGATGG - Intronic
1141547385 16:84780155-84780177 ATAGAAACAAGGGATGAGGAGGG - Intergenic
1141559451 16:84857406-84857428 TTGGGAAAGAGGGATGTGGATGG - Intronic
1141804218 16:86332152-86332174 ATGGCAAAGAGGGATTAAGGTGG - Intergenic
1141845220 16:86603891-86603913 AAGGAAAGGAAGGAGGAGGAGGG - Intergenic
1141867696 16:86762059-86762081 ATGGAAAATCAGAATGAGGAAGG + Intergenic
1142220686 16:88853554-88853576 TTGGAAAATAGGGTTAAGGAGGG - Intronic
1142329833 16:89444702-89444724 TTGGAAAACAGGAAGGAGGATGG + Intronic
1142498225 17:317658-317680 AGGGAAAACTGGGCTGAGGAAGG - Intronic
1142632061 17:1231498-1231520 CTGGAAAAGTGGGACCAGGACGG - Intergenic
1143182537 17:4992641-4992663 AAGGAAAAGAGGGGAGGGGAGGG - Intronic
1143280875 17:5753230-5753252 AGAGAAAAGAGGAAAGAGGAAGG - Intergenic
1143372809 17:6450797-6450819 AGGGAAAGGAGGGATGAGAGTGG - Exonic
1143478005 17:7214010-7214032 AGGGAAATGGGGGATGGGGAAGG - Intronic
1143727522 17:8859632-8859654 TAGGAGAAGAGGGAGGAGGAAGG + Intronic
1143849182 17:9796826-9796848 CTGGAATAGAGTGAGGAGGAAGG + Intronic
1143900336 17:10169699-10169721 ATGGAGAAGAGGTCTGGGGATGG - Intronic
1143924844 17:10360478-10360500 ATGGAAAAGGGCGATGGGAAAGG - Intronic
1144083177 17:11783203-11783225 GTGGAAAAGAGGGATGAGGAAGG + Intronic
1144083573 17:11786406-11786428 ATGGAAAGGAGAGATGAGGTTGG + Intronic
1144096141 17:11902418-11902440 ATGGAAAAGAGGGGCAAGAAGGG - Intronic
1144102833 17:11959215-11959237 ATGAACAAAAGTGATGAGGATGG - Intronic
1144595648 17:16568461-16568483 CTGGAAAAGAGTGAAGAGGTTGG + Intronic
1144656693 17:17041911-17041933 ATGTAAAATGGGGATGAGAAAGG + Intergenic
1145415089 17:22708283-22708305 ATGCAAAGGAGGGATGGGGGAGG - Intergenic
1145777398 17:27539005-27539027 CTGGAAGGGAGGGATGGGGAAGG - Intronic
1146488450 17:33262465-33262487 ATGGAAGGGAGGGAAAAGGAAGG + Intronic
1146564595 17:33901476-33901498 ATGAAAAAGAGGAATAAGGGAGG - Intronic
1147134354 17:38426653-38426675 TTGATAAAAAGGGATGAGGAAGG + Intergenic
1147317993 17:39629903-39629925 ATGGAATGGAGGGATGGTGAAGG + Intronic
1147402670 17:40190555-40190577 CTGGAATGGAGGGCTGAGGAGGG + Intronic
1147527066 17:41235800-41235822 AGGGAAAAGAGGGAGCAGGGAGG + Intronic
1148528487 17:48365908-48365930 GTGGAAAAGAGGGATGAGGAAGG - Intronic
1148712706 17:49693378-49693400 AAGGAAAGGAGGGAGGAGGAAGG - Intergenic
1148780770 17:50120338-50120360 AAGAAAAAGAGGGGAGAGGATGG + Intronic
1148805934 17:50264044-50264066 AGGGAAAAGAGAGAGGGGGAGGG + Intergenic
1148863862 17:50618623-50618645 GTGGAATAGAGGGGTGAGGCTGG - Intronic
1149891084 17:60391531-60391553 ATGGCAATGAAGGATGAGGGGGG + Intronic
1150118560 17:62578232-62578254 ATGGAGAGGAGGGAGGAGGAGGG + Intronic
1150520076 17:65857173-65857195 GCAGAAAAGAGGGATGAGGAAGG - Intronic
1150585066 17:66510082-66510104 GCAGAAAAGAGGGATGAGGAAGG + Intronic
1150683722 17:67303612-67303634 AGTGAAAAGAAGGATGATGAGGG + Intergenic
1150919544 17:69468740-69468762 GCAGAAAAGAGGGATGATGAAGG - Intronic
1150936762 17:69644064-69644086 ATGGAAAAGAGGGATGAGGAAGG - Intergenic
1150998662 17:70348791-70348813 ATGGAAAAGAGGGATGAGGAAGG - Intergenic
1151050958 17:70978401-70978423 AGAAAAAAGAGGGATGGGGATGG + Intergenic
1151120402 17:71786794-71786816 GTGAAAAAGAGGGATCAGGAAGG - Intergenic
1151144903 17:72031504-72031526 TTGGCAATGAGGGATGAGGGGGG - Intergenic
1151657939 17:75504330-75504352 ATGGAAAGGTGGCAGGAGGAAGG + Intronic
1151678186 17:75610536-75610558 ATGCAAAAGAGGGGAGCGGACGG - Intergenic
1152009385 17:77701838-77701860 ATGAAAGGGAGGAATGAGGATGG - Intergenic
1152731672 17:81975103-81975125 AAGAAGAAGAGGGAGGAGGAAGG - Intergenic
1153014827 18:574070-574092 ATGGAAAAGTGTGAGGAGGAAGG - Intergenic
1153104037 18:1507415-1507437 ATGGGAGGGAGGGATAAGGAGGG - Intergenic
1153269975 18:3310748-3310770 GTGGAAAAGAGGAGTGAGGGAGG + Intergenic
1153356978 18:4148051-4148073 ATGGAAAAGAGAGACAAGGATGG - Intronic
1153574114 18:6503962-6503984 AGAGAAAGGAGGGAGGAGGAAGG + Intergenic
1153696984 18:7653466-7653488 ATGGGAAAGAGGGCAGAGGGTGG - Intronic
1154145739 18:11865033-11865055 ATGGAAAAGAGCTTTGTGGAGGG - Intronic
1154331863 18:13436630-13436652 ATGGAAAAAAGGGATGTCAAGGG - Intronic
1154490354 18:14917387-14917409 AAGGGAAAGATGGAAGAGGAAGG - Intergenic
1155686454 18:28558008-28558030 ATGGTATAGGGGGATGAGTATGG - Intergenic
1155868757 18:30998974-30998996 AAGAAAAAGAGAGATGTGGAGGG + Intronic
1155882829 18:31170949-31170971 ATGGAGAAGATGAAGGAGGATGG + Intergenic
1156018891 18:32577374-32577396 ACAGAAAAGAGGGAGGAAGAAGG - Intergenic
1156232366 18:35165958-35165980 ATGGAAAAGAAAAAGGAGGATGG + Intergenic
1156316102 18:35970547-35970569 ATGGAAAGGTGGGAAGAGCAGGG + Intergenic
1156491374 18:37498403-37498425 GGGGAGAAGAGGGAAGAGGAGGG - Intronic
1156796638 18:41053897-41053919 GTGAAATAAAGGGATGAGGAGGG - Intergenic
1156825514 18:41426241-41426263 AAGTGAAAGAGAGATGAGGATGG - Intergenic
1156988585 18:43379110-43379132 ATGGTAAACAGGAATTAGGAAGG - Intergenic
1157120792 18:44909163-44909185 ATTGAAAGGAAGGATGAGTAAGG + Intronic
1157163308 18:45335140-45335162 ATGGAAAGGAGGGATGACAAAGG - Intronic
1157301201 18:46481014-46481036 CTGCAAAAGAGGGATCAGAATGG + Intronic
1157303667 18:46500101-46500123 ATGGAAAAGAAGGAAGAGGAGGG - Intronic
1157470802 18:47986612-47986634 AAGGAAAGGAGTGATGAGGAAGG + Intergenic
1157479185 18:48042193-48042215 GTGGAAAAGAGGGATGAGGAAGG - Intronic
1157732249 18:50014256-50014278 ATGGAGAAAATGGATGAGAAAGG + Intronic
1157763835 18:50283173-50283195 AAGGAAAAGTGAGGTGAGGAAGG + Intronic
1157795362 18:50569619-50569641 GCGGAAAACAAGGATGAGGAAGG - Intronic
1157927456 18:51781816-51781838 GCAGAAAAGAGGGATGAGGAAGG + Intergenic
1157941568 18:51934438-51934460 ATGGATAAGAGGGAGGTGGGAGG + Intergenic
1158009928 18:52716900-52716922 ATTAAAAACAGGGAAGAGGATGG + Intronic
1158470074 18:57728435-57728457 AAAGGAAAGAGGGATGAAGAGGG + Intronic
1158927311 18:62281015-62281037 GTAGAAAAGAGGGAAGAGGAAGG - Intronic
1159310597 18:66702573-66702595 ATGGAAGTGAGGCTTGAGGATGG + Intergenic
1159469435 18:68832578-68832600 GTGGAAAAGAGGGATGAGGAAGG + Intronic
1159725124 18:71947964-71947986 AAGGAAAAGAGGAAGGAAGAGGG + Intergenic
1159866235 18:73708394-73708416 CTGGCAAACAGGGATGAGAATGG + Intergenic
1159933258 18:74336568-74336590 AAGGAAAAGAGGGCTGAAAATGG - Intronic
1160102410 18:75935350-75935372 ATGGAGAAGTGAGATCAGGAGGG + Intergenic
1160239028 18:77109420-77109442 AGGGAAAAAAGTGAAGAGGAAGG + Intronic
1160356105 18:78229566-78229588 AAGGAAGGGAGGGAGGAGGAAGG - Intergenic
1160607776 18:80065418-80065440 ACAGAAAAAAGGAATGAGGAAGG + Intronic
1160676843 19:395529-395551 ATGGAGAAGGGTGATGGGGAAGG + Intergenic
1161357310 19:3826191-3826213 AGGGGAAAGAGGAATGAGCAGGG - Intronic
1161496008 19:4586056-4586078 AGGGTAAAGAGGGATGAAGAGGG - Intergenic
1161665685 19:5574818-5574840 AAGGAAGAGAGGGGGGAGGAAGG + Intergenic
1161918740 19:7250353-7250375 AAGGGAAAGAGGAAGGAGGAGGG + Intronic
1162006599 19:7784469-7784491 ATGGTACAGAGGGAGGAGGAAGG - Intergenic
1162155920 19:8677891-8677913 ATGGAAAGGAGGAAGGAAGAGGG - Intergenic
1162171753 19:8795251-8795273 GCAGAAAAGAGGGATGAGGATGG - Intergenic
1162232795 19:9281627-9281649 AGGGTAAAGAAGGATGGGGAAGG + Intergenic
1162298552 19:9829905-9829927 ATGGATGAGAGGGGTGGGGACGG + Intronic
1162799106 19:13101274-13101296 ATGGGAAGGAGGGAGGGGGAGGG + Intronic
1162835455 19:13314188-13314210 ATAGAAAGGAGAGATGAGGAGGG + Intronic
1163105781 19:15122435-15122457 AGGGAAAAGGAGGAGGAGGAGGG + Intronic
1163116068 19:15189220-15189242 CTGGGAAAGAGGGGAGAGGAGGG - Intronic
1163174857 19:15557128-15557150 ATGGAGAAGAGGGATGGGGAAGG - Intergenic
1163298942 19:16430890-16430912 ATGGATCATAGGGATGCGGAGGG + Intronic
1163779166 19:19237197-19237219 AAGGAAAAGTAGGCTGAGGATGG - Intronic
1163779540 19:19239351-19239373 AGGGAAAGGAAGGAGGAGGAGGG - Intronic
1164419464 19:28075924-28075946 ATGGAAGAGGAGGATGAGGGAGG + Intergenic
1164466061 19:28488675-28488697 AAGGAAGAGAGGGAGGAGGAAGG - Intergenic
1164771958 19:30816305-30816327 AGGGAAGAGAGGGAGGGGGAAGG - Intergenic
1165233122 19:34399859-34399881 AGGGAAGAGTGGTATGAGGAAGG - Intronic
1165387943 19:35522679-35522701 AGGGGAAAGAGGGAGAAGGATGG - Intergenic
1165459892 19:35938091-35938113 ATGTCAAAGATGGATGGGGACGG - Intronic
1165468752 19:35990732-35990754 AGGGAAAAGAAGGAAGAAGAAGG + Intergenic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166142894 19:40814705-40814727 AGGGAAAAGAGGGGAGGGGAGGG - Intronic
1166158726 19:40935839-40935861 ACAGAAAAGAAGGATGAGGAAGG + Intergenic
1166167656 19:41003743-41003765 ACAGAAAGGAAGGATGAGGAAGG + Intronic
1166184664 19:41132107-41132129 AGGGAAAAGAGGGGAGGGGAGGG + Intergenic
1166834597 19:45659461-45659483 ATGGAAAAAGGGGAAGAGAAAGG + Intergenic
1166911343 19:46160481-46160503 ATGGGCAAGAGTGAAGAGGAAGG + Intronic
1167189491 19:47974589-47974611 ATGGAAAGGAGGGAGGAGAGAGG - Intronic
1167189961 19:47979169-47979191 ATGGAAGAGGAGGAGGAGGAGGG - Intronic
1167298087 19:48663602-48663624 ATGGAACGGAGGGATGGGCAGGG - Intronic
1167384003 19:49153562-49153584 AGGGAAGAGAGGGCTGAGGTTGG - Exonic
1167461693 19:49628116-49628138 ACAAAAAAGAGGGATGAGGAAGG - Intergenic
1167695829 19:51015256-51015278 ATTGAGGATAGGGATGAGGAGGG + Intronic
1167714981 19:51137396-51137418 AGGGAATGGAGGGAGGAGGAAGG - Intergenic
1167983308 19:53294287-53294309 GCAGAAAAGAGGGTTGAGGAAGG + Intergenic
1168351318 19:55677768-55677790 ATGGGAAAGAAGGCTGATGAAGG - Intronic
1168382533 19:55936198-55936220 CTGAAAAGGAGGAATGAGGAGGG + Intergenic
1168399753 19:56078551-56078573 GTGGAAAAGAGGGATGAGGAAGG - Intergenic
1168495589 19:56845896-56845918 ATGGAAAAGAAGGAAGAATATGG - Intergenic
1168517112 19:57017662-57017684 AGGGAGATGGGGGATGAGGAGGG - Intergenic
1168517152 19:57017763-57017785 AGGGAGATGGGGGATGAGGAGGG - Intergenic
1168539242 19:57196773-57196795 CTGGGGAAGAGGGATGTGGATGG - Intronic
1168659395 19:58154627-58154649 AAGGAAAAAAAGGACGAGGAAGG - Intronic
1202697537 1_KI270712v1_random:135847-135869 AAGAAGAAGAGGGAGGAGGAGGG - Intergenic
925232907 2:2251847-2251869 AAGGAAGGGAGGGAGGAGGAAGG + Intronic
925445555 2:3923951-3923973 AAGGAAAGGAGGGAAGGGGAAGG - Intergenic
925476435 2:4221916-4221938 CTGGAGAAGAGAGATGGGGAAGG + Intergenic
925732985 2:6935480-6935502 CAGGAAAAGAGGCCTGAGGATGG - Intronic
925831891 2:7904016-7904038 CAGGAGAAAAGGGATGAGGATGG - Intergenic
925858250 2:8151022-8151044 ATGGAAAAGAGAGTTGTGGGAGG + Intergenic
925881039 2:8352932-8352954 AGGGAAGGGAGGGAAGAGGAAGG + Intergenic
926119899 2:10236215-10236237 ATGGAGAAGAGGGAAGAGGGTGG - Intergenic
926544887 2:14227169-14227191 ATGGAAGAAAGGGAGGAAGAGGG + Intergenic
926715400 2:15920109-15920131 AAGGAAGAGAGGGAGGAGGGGGG - Intergenic
926756778 2:16242918-16242940 GTGGAAATGAGGGAGGAAGAAGG - Intergenic
926794595 2:16608473-16608495 ATGGCCAAGTGGAATGAGGACGG + Intronic
926887696 2:17613040-17613062 AGGACAAAGAAGGATGAGGATGG - Intronic
926913547 2:17873011-17873033 AGGCAAAAGAGGGAAGGGGAAGG + Intergenic
926974035 2:18495438-18495460 AAGGAAAAAAGGGAGGGGGAGGG - Intergenic
927414120 2:22858976-22858998 AGAGAAAGGAGGGATGGGGACGG - Intergenic
927416263 2:22883817-22883839 ATGGAAAAAAGGGAAGAGGAGGG + Intergenic
927955651 2:27205661-27205683 GTATAAAAGAGGGATGACGAAGG + Intronic
928012283 2:27621059-27621081 ATGGAAAAAAGGCATGATTAGGG - Intronic
928215071 2:29354555-29354577 ATTGAGAAGAAGGATGAAGAAGG - Intronic
928218197 2:29380073-29380095 GAGGAAAAGAGCAATGAGGAAGG + Intronic
928581133 2:32708767-32708789 GTGGAAAAGGGGGATGAGGAAGG + Intronic
928652714 2:33419460-33419482 AGGGAAAAGAGGGAAGAGATTGG + Intergenic
928706296 2:33953116-33953138 ATGAAAAAGAGGGCTTATGAAGG - Intergenic
928756282 2:34529509-34529531 GTGGAAAAGGGTGATGGGGAAGG - Intergenic
928947029 2:36780840-36780862 ATGGAAAAGAGAGGAAAGGAGGG + Intronic
929021416 2:37557401-37557423 CAGGAAAAGAGGGGTGTGGAGGG + Intergenic
929175001 2:38967300-38967322 CTGGAGAAGGGGGAAGAGGAAGG + Intronic
929269283 2:39955814-39955836 ATGGGAAAGAGTGAAGAGAAAGG - Intergenic
929444462 2:41991845-41991867 AGGGGAAGGAGGGAGGAGGAGGG + Intergenic
929496296 2:42447085-42447107 AAAAAAAAAAGGGATGAGGAAGG + Intronic
929566201 2:42986934-42986956 ATGGGAAAGAGGTAGAAGGAAGG - Intergenic
929733861 2:44524566-44524588 ATGAAGATGAGGGAAGAGGAAGG - Intronic
929904765 2:46036217-46036239 AGGGGAAAGTGGGATGAGGTGGG + Intronic
930168593 2:48228904-48228926 ATGGTAAAGATGGTTGAGGGTGG - Intergenic
930247698 2:49002311-49002333 ATTGTAAAGAGAGAAGAGGAAGG - Intronic
930350064 2:50240382-50240404 ATGTAGAAGAGAGCTGAGGAAGG - Intronic
930624306 2:53679469-53679491 ATGGAGAAGAAAGATGAGGATGG - Intronic
930837410 2:55808883-55808905 AGAGAAAATAGGGATGAGAATGG - Intergenic
931208205 2:60167862-60167884 GTAGGAAAGAGGGATCAGGAGGG + Intergenic
931216225 2:60247493-60247515 ATGGAAAAGGGAGAGGAAGATGG - Intergenic
931624589 2:64245329-64245351 GTGGAAATGGGGGATGGGGAAGG - Intergenic
931701316 2:64911337-64911359 ATAGAAGAAAGGGATGATGAAGG - Intergenic
931705866 2:64945557-64945579 AAGGAAAAAAGGGAAGAGGGAGG - Intergenic
932457693 2:71860032-71860054 ATGGCAGGGAGGGATGACGAAGG + Intergenic
932627485 2:73309119-73309141 AGGGACAAGGGGCATGAGGAAGG - Intergenic
932727215 2:74189765-74189787 ATGGAAAAGAAGGAAAAGGACGG + Intergenic
932894486 2:75625972-75625994 ATGGAAAAGAGGCAAGAGTGGGG - Intergenic
933177947 2:79196952-79196974 CTGAAAAAGAGGGATGCTGATGG - Intronic
933216327 2:79634711-79634733 AAGGAAAACAGGGATGAAGCTGG + Intronic
933262182 2:80142934-80142956 GTGGAAAAGAGAGATGAAAAGGG + Intronic
933473131 2:82753017-82753039 ATGGAGAAGAGGGAAGTGGAGGG + Intergenic
933759037 2:85661832-85661854 ATGGAAAAGGGGGATGGGAAGGG - Intronic
933769673 2:85735041-85735063 AAGGAGAAGAGGGAACAGGAAGG + Intergenic
934042587 2:88141007-88141029 AAAGAAAAGAGGGAGGAGGGAGG - Intergenic
934138477 2:89020603-89020625 AGGGAAATGAGGGAGGATGATGG - Intergenic
934144562 2:89078702-89078724 AGGGAAATGAGGGAGGATGATGG - Intergenic
934159479 2:89234830-89234852 AAGGAGATGAGGGAGGAGGAGGG - Intergenic
934207798 2:89947601-89947623 AAGGAGATGAGGGAGGAGGAGGG + Intergenic
934224690 2:90121847-90121869 AGGGAAATGAGGGAGGATGATGG + Intergenic
934230767 2:90179950-90179972 AGGGAAATGAGGGAGGATGATGG + Intergenic
934278709 2:91592871-91592893 AAGAAGAAGAGGGAGGAGGAGGG - Intergenic
934653224 2:96104137-96104159 AAGGAAAAGGAGGAGGAGGAGGG - Intergenic
934726097 2:96620308-96620330 ATGGAAAAGAGAGATTAGTGTGG - Intronic
934987295 2:98896824-98896846 GTGGAAAAGAGGGATGAGGAAGG + Intronic
935090952 2:99894347-99894369 AGAGAAAAAAGGGAGGAGGAAGG + Intronic
935163387 2:100548583-100548605 GCAGAAAAAAGGGATGAGGAAGG - Intergenic
935302031 2:101701342-101701364 ATGGAAGAAAGGGAGGGGGAGGG + Intronic
935367116 2:102306328-102306350 AAGCAAAAGAATGATGAGGAAGG + Intergenic
935441554 2:103103919-103103941 ATGGAAAAGGAGGAAGAGAAAGG - Intergenic
935443989 2:103137294-103137316 AAGGAAAAGAGGGCTGAGAATGG + Intergenic
935609629 2:105007808-105007830 GTGGAAAACAAGGATGAGGAAGG + Intergenic
935716918 2:105947603-105947625 ATTGCAAAGAGGGAGGAGGTGGG + Intergenic
935901130 2:107794998-107795020 GTGGGATAGTGGGATGAGGAGGG + Intergenic
936235285 2:110737219-110737241 AAAGAAATGAGGGATGAAGAGGG - Intronic
936448880 2:112618529-112618551 AGGGAAAGGAGGAATGAAGAAGG + Intergenic
936470657 2:112796023-112796045 AGGAAACAGAGGGATGGGGAGGG + Intergenic
936628254 2:114172193-114172215 ATAGAACAAAGGGTTGAGGAAGG + Intergenic
936820085 2:116510127-116510149 ATGGAAAGGGGGAAAGAGGAAGG - Intergenic
937318153 2:120945073-120945095 GAGGGAAAGAGGGAAGAGGAAGG + Intronic
937524711 2:122754371-122754393 AAGCAGAAAAGGGATGAGGAAGG - Intergenic
937635637 2:124152654-124152676 AAGGTAGAGAGGAATGAGGAGGG + Intronic
937800460 2:126075754-126075776 TTGGAGAAGAGGTATGTGGATGG + Intergenic
937887215 2:126908131-126908153 ATGGAAATAGGGGATAAGGATGG + Intergenic
938198590 2:129354633-129354655 ATGGAAAAGGGAGCTGAGTAAGG - Intergenic
938272825 2:129990256-129990278 AAGGAAGAGAAGGAGGAGGAGGG + Intergenic
938443405 2:131355852-131355874 AAGGAAGAGAAGGAGGAGGAGGG - Intergenic
938466870 2:131530386-131530408 ATGGAGAAGGGGGTTGAGGGAGG + Intronic
938755608 2:134376331-134376353 AAGAAAAGGAGGGAAGAGGAAGG - Intronic
939167327 2:138653710-138653732 ATAGATAATGGGGATGAGGATGG + Intergenic
939422837 2:141995911-141995933 GTGGAAAAGAGGGAAGAAAAAGG + Intronic
940472005 2:154112496-154112518 TTGGGGAAGAGGGATGTGGATGG - Intronic
940678383 2:156752909-156752931 GCAGAAAAGAGGGACGAGGAAGG - Intergenic
940911181 2:159211461-159211483 AAGGAAAAGAGGGCAGGGGAGGG - Intronic
941338331 2:164272703-164272725 ATGGAAAAAAAAGAAGAGGAGGG - Intergenic
941406673 2:165098572-165098594 GTGGAAAAGAGGGATGAGGAAGG - Intronic
941943038 2:171063832-171063854 CTCCAAAAGAGGGATGAGGTGGG + Intronic
943012827 2:182472554-182472576 AAGGGTATGAGGGATGAGGAGGG + Intronic
943088164 2:183340592-183340614 ATGGAGAAGAAGGTTCAGGAGGG - Intergenic
943956555 2:194199332-194199354 ATGGAAAAGAGGGAAGTCTAGGG - Intergenic
944089074 2:195884478-195884500 ATGGTAAATAGTGATGATGAAGG + Intronic
944212901 2:197225051-197225073 AGGGAGAAAAGGGAAGAGGAGGG + Intronic
944667494 2:201969622-201969644 ATGGCAGAGAAGGATGAGGAAGG - Intergenic
944949861 2:204736080-204736102 ATAGAAAAGAGGGAGTAAGAGGG - Intronic
945068802 2:205970616-205970638 ATGAGAAAGAGAGAAGAGGACGG - Intergenic
945459728 2:210091784-210091806 ATGGAAAATTGGGATGAAGAAGG - Intronic
945540708 2:211082517-211082539 AGAGAAAAGGGAGATGAGGAGGG + Intergenic
945544950 2:211138774-211138796 TTGGGAAAGAGGTATGTGGATGG + Intergenic
945708360 2:213264726-213264748 ATGGACAAAATGGATGAAGAAGG + Intergenic
945889517 2:215413569-215413591 ATGGAACAGAAAGATGAGGATGG - Intronic
945985393 2:216349640-216349662 ATGGAAAAGAGGCCTCAGGGGGG + Intronic
946225995 2:218264433-218264455 AGGGCACAGAGGGAAGAGGAGGG - Exonic
946313614 2:218896261-218896283 AGGGAAAAGTAGGAGGAGGAAGG + Intronic
946558775 2:220889536-220889558 ATGGAAGACAGTGAGGAGGAGGG - Intergenic
946717076 2:222563921-222563943 GAGGAAGAGAGGGAAGAGGAGGG + Intergenic
946895458 2:224319274-224319296 ATGGAAAGGAGAGGAGAGGAGGG + Intergenic
947154611 2:227149421-227149443 GCAGAAAAGAGAGATGAGGAAGG - Intronic
947220863 2:227791219-227791241 ACAGAAAAGAGGGAGGAGGAAGG + Intergenic
947233886 2:227920031-227920053 ATGGAAAAGTGGGGTGTGGGAGG + Intronic
947795482 2:232891388-232891410 CTGGAAAGGCAGGATGAGGAAGG + Exonic
948262242 2:236613015-236613037 ATGGAGCAGAGGGAGGAGGGCGG - Intergenic
948303071 2:236923011-236923033 ATAGAAGAGAGGAAGGAGGAAGG - Intergenic
948441382 2:237992626-237992648 AAGGAAATGAGGCATGAGGTAGG + Intronic
948874124 2:240818367-240818389 CTGGACCGGAGGGATGAGGAGGG - Intronic
1168865747 20:1084976-1084998 ATGGAAAAGATGTGTTAGGATGG - Intergenic
1169009847 20:2241368-2241390 AAGAAAAAGAGGGAGGAGGGAGG - Intergenic
1169021384 20:2333772-2333794 ATGGAAAAGAGAGAGAAGGCAGG + Intronic
1169038088 20:2470199-2470221 ATGGAGAGGAGGGCGGAGGAGGG - Intronic
1169651321 20:7870892-7870914 GTGGAGAAGAGGGAAGAGAAGGG - Intergenic
1169702114 20:8458393-8458415 ATGATTAAGATGGATGAGGAGGG - Intronic
1169850034 20:10037992-10038014 ATGGTAAAGTGTGATGAGGAGGG + Intronic
1171093127 20:22305024-22305046 ATGGAAAAGAAGAAAGAGGAAGG - Intergenic
1172105802 20:32516742-32516764 CTGGCAAGGAGGGATGTGGAGGG + Intronic
1172536912 20:35681004-35681026 AAGGAAAAGAGGAAGGAGAAGGG - Intronic
1172736345 20:37128709-37128731 GCGGAAAAGAGGTATGAGGAAGG - Intronic
1172869522 20:38127034-38127056 GTGGGAAAGAGGCCTGAGGAGGG + Intronic
1173037256 20:39424377-39424399 GTGGAAATGGGGGATGAGAAAGG + Intergenic
1173040356 20:39456321-39456343 AGGGGAAGCAGGGATGAGGATGG - Intergenic
1173139948 20:40473104-40473126 ATGAATAAGATGGATGAGTAAGG - Intergenic
1173201532 20:40958786-40958808 GTGGGAAAGCGGGATGGGGAGGG - Intergenic
1173284718 20:41659814-41659836 ATGGAGGTGAGAGATGAGGATGG - Intergenic
1173860773 20:46282172-46282194 TTGGCAAAGAGGGAAGAGAATGG + Intronic
1173909430 20:46653431-46653453 GTGGAAAAGAGGGATGAGGAAGG - Intronic
1174096082 20:48090695-48090717 AAGGCAAGGAGGGATGAAGATGG + Intergenic
1174484919 20:50855116-50855138 ATGGAATGGAGGGCTGAAGATGG - Intronic
1174796391 20:53526070-53526092 AAGGAAAGAAGGAATGAGGATGG - Intergenic
1174945593 20:54981795-54981817 ATGAAACAAAGAGATGAGGATGG + Intergenic
1175035923 20:56001855-56001877 ATGAGAAAGAGGGATTGGGATGG + Intronic
1175244198 20:57571804-57571826 GTTGAAAAGAGAGCTGAGGAAGG + Intergenic
1175485003 20:59339476-59339498 ATGGAGGAGAGGGACAAGGAAGG + Intergenic
1175522800 20:59612934-59612956 AAGCAAGAGAGGGATGAGGAAGG + Intronic
1176191006 20:63809543-63809565 AGGGAGAAGAGGGGAGAGGAAGG - Intronic
1176854366 21:13953470-13953492 AAGAGAAAGAGAGATGAGGAGGG - Intergenic
1176954488 21:15085507-15085529 ATGGAAAGGAAGGATGATCAAGG - Intergenic
1177006152 21:15674103-15674125 ATAGAAAAGATGGGTGAGGCCGG - Intergenic
1177116047 21:17088198-17088220 AGGGCAAGGAGGGAGGAGGAAGG + Intergenic
1177913262 21:27056839-27056861 TTGGGAAAGAGGTATGTGGATGG + Intergenic
1178005962 21:28219804-28219826 TTGGGGAAGAGGAATGAGGATGG - Intergenic
1178341889 21:31792783-31792805 ATGGAAACGAGGGCTGCAGATGG - Intergenic
1179081181 21:38172037-38172059 TTGGGGAAGAGGCATGAGGAGGG + Intronic
1179415062 21:41191908-41191930 TTGGGGAAGAGGGATGTGGATGG - Intronic
1179440009 21:41386909-41386931 GTGGAAAAGTGGGATGAGGAAGG - Intronic
1179629449 21:42667522-42667544 AAGGAAGAGAGTGGTGAGGAGGG + Intronic
1180059091 21:45375504-45375526 ATGGAGGAGGGGGAGGAGGAGGG + Intergenic
1180168152 21:46040653-46040675 ATGGAAAAGAGGGATCTCGGAGG - Intergenic
1180861083 22:19083388-19083410 GTGAAGAAGAGGAATGAGGAGGG - Intronic
1180918664 22:19506944-19506966 AACGAAAAAAGGGCTGAGGATGG + Intronic
1181489092 22:23250448-23250470 GTGGAAAAGAGGGATGAGGAAGG + Intronic
1181666487 22:24402014-24402036 ATGGTAAAGAGGGAGCAAGAAGG - Intronic
1181760873 22:25057935-25057957 ATTCAAAGGAGGGATGAGGCTGG - Intronic
1181791236 22:25268447-25268469 AAGGAAAAGAGGAATGAGACAGG + Intergenic
1182044384 22:27262827-27262849 ATGGAAGAGGGGGAGGCGGAGGG + Intergenic
1182159426 22:28106729-28106751 AAGGATAATAGGGATGGGGAAGG - Intronic
1182407821 22:30152730-30152752 AAGCAAAAGAGGGAAGTGGATGG - Intronic
1182480711 22:30607061-30607083 AGGGAACAAAGGGAGGAGGAGGG - Exonic
1183034860 22:35133921-35133943 ATGGAGACAAGGGAGGAGGAAGG + Intergenic
1183306153 22:37084236-37084258 AGGGAAGAGAGGGAGGGGGAGGG + Intronic
1183652998 22:39169754-39169776 CTGGAAAAAGGGGAGGAGGAGGG - Intergenic
1183913499 22:41097352-41097374 ATGGATAATAGGGAGGAGGGAGG + Intronic
1184238925 22:43201536-43201558 ATAGAAAAGAAGGAGGAGGAAGG + Exonic
1184297832 22:43537036-43537058 ATGGAAAAGGTGGAGGAGGGCGG - Intronic
1184468033 22:44680388-44680410 AAGGAAAGGGGGGATGGGGAAGG + Intronic
1184717707 22:46291296-46291318 GTGGACAGGAGGGCTGAGGATGG + Intronic
1184797009 22:46738383-46738405 GGGGAGAAGAGGGAGGAGGAAGG + Intergenic
1184815775 22:46868579-46868601 ACGGAAGGCAGGGATGAGGAAGG - Intronic
1184836953 22:47029491-47029513 AGGGAAGGGAGGGAAGAGGAGGG - Intronic
1184949929 22:47834051-47834073 TTGGAAAAGTGGCAAGAGGAAGG + Intergenic
1185055980 22:48578574-48578596 ATAGGAAGGTGGGATGAGGATGG + Intronic
1185288189 22:50011579-50011601 ATGGAAAACAGGGAGGGGGCAGG - Intronic
949530634 3:4951773-4951795 GTGGAAAAGAGGGATGAGGAAGG + Intergenic
949875791 3:8625254-8625276 AAGGAAAAGAGCGAGGAAGAAGG + Intronic
950358820 3:12435812-12435834 GTGGAAAAGAGGGATGAGGAAGG - Intergenic
950431690 3:12954523-12954545 AAGGAAAAGAGGGATTTGCAGGG + Intronic
950626442 3:14250889-14250911 GCGGAAAAGAGGGATGAGGAAGG + Intergenic
950694857 3:14690960-14690982 ATGGAGGTGAGGGCTGAGGAAGG - Intronic
950753899 3:15156035-15156057 AGGGAAAGGAGGGAAGAGGAGGG + Intergenic
950979438 3:17286789-17286811 ATGGAAAGGTGGTCTGAGGATGG + Intronic
951668549 3:25154672-25154694 ATGGAAAGGAAGGATCTGGATGG - Intergenic
951990135 3:28667578-28667600 ACAGAAAAGAGGGGTGAGGAAGG - Intergenic
952573106 3:34741649-34741671 ATGGAAGAAATGGATGAGAAAGG - Intergenic
952606146 3:35149125-35149147 GGGTAAGAGAGGGATGAGGAAGG - Intergenic
952798347 3:37263389-37263411 GCGGGAAAGAGGGATGAGGAAGG + Intronic
953283226 3:41579133-41579155 ATGGGAAAGAGGGAAAGGGAAGG + Intronic
953296215 3:41719988-41720010 TTGGCAAAGAGGGAAGAGAAGGG - Intronic
953358538 3:42275143-42275165 AGGGAGAAGAGGGAATAGGAAGG + Intergenic
953578738 3:44134486-44134508 GTGGGAAAGTGGGATGTGGAAGG + Intergenic
953831347 3:46300077-46300099 AAGGAAAAGAGAGGAGAGGAAGG + Intergenic
953902207 3:46849772-46849794 CTGGAAAAGAGGTTGGAGGAGGG + Intergenic
954130579 3:48558715-48558737 CTGCAAAAGGAGGATGAGGAAGG - Intronic
954295305 3:49671297-49671319 AAGGGAGAGAGGGAGGAGGAAGG - Exonic
954613564 3:51958481-51958503 ATGGGAAAGGTGGAAGAGGAAGG + Intronic
954876509 3:53806143-53806165 AGGGAAAAGAAGGAGGAGGAGGG - Intronic
954930453 3:54276664-54276686 AGGGAAAAGAGGAATTAGGGAGG + Intronic
954991533 3:54844562-54844584 TTGGAATAGAGAGATGAGAAGGG - Intronic
955191421 3:56765295-56765317 GCGGAAAAGAGGGATAAGGAAGG + Intronic
955609851 3:60745395-60745417 AAGGAATAGAGTGATGAAGATGG + Intronic
955651683 3:61201591-61201613 ATGGAATAGAGGGATGTGGAGGG - Intronic
955933723 3:64082574-64082596 AGGGAAAAGAAGGAAGAGGGAGG - Intergenic
956022923 3:64951285-64951307 ATGTAAAGGAGGGACCAGGAAGG - Intergenic
956141020 3:66147137-66147159 AAAGAAAAGAGGGACGGGGAGGG - Intronic
956403414 3:68903901-68903923 ATGGAAAGGAGGAAAGAGGGAGG - Intronic
956657677 3:71568021-71568043 AAGGAAAGGAGGGAAGGGGAGGG + Intronic
956664640 3:71631044-71631066 AATGGGAAGAGGGATGAGGAAGG - Intergenic
956741402 3:72279142-72279164 GTGGAAAAGAGAGAAAAGGAAGG + Intergenic
956842659 3:73155036-73155058 ATCAAAAAGGGGGAAGAGGAGGG - Intergenic
956920754 3:73926730-73926752 TTGGGGTAGAGGGATGAGGAAGG - Intergenic
957605605 3:82394844-82394866 AGGGAAAGGAGGGAAGAGCAGGG - Intergenic
957944377 3:87043931-87043953 GTGGAAAAGAGGGATGAGAAAGG + Intergenic
957954172 3:87162103-87162125 ATGGAAGAGAGGGAGGATAAAGG - Intergenic
958443631 3:94187662-94187684 AGGGAAAGGAGGGATGAAAAAGG - Intergenic
958616623 3:96501478-96501500 AGGGAACAGAGGCATGAGTATGG + Intergenic
958877735 3:99635039-99635061 ATGGAGAGGAGGGATGAGGAGGG - Intergenic
959015821 3:101132886-101132908 GTGGAAAAGAGGGATGAGGAAGG - Intergenic
959403150 3:105928027-105928049 ATGGAAAAGAGGGGAAGGGAAGG - Intergenic
959463803 3:106659999-106660021 ATGGAAAGAAGGCATGAGTATGG + Intergenic
959550623 3:107651933-107651955 GCAGAAAAGAGGGCTGAGGAAGG + Intronic
960409739 3:117308305-117308327 ATGAATGGGAGGGATGAGGAAGG + Intergenic
960680633 3:120243906-120243928 GAGGGAAAGGGGGATGAGGAAGG - Intronic
960740958 3:120832956-120832978 ATGGAAAAGAGAGAGAAGAAAGG - Intergenic
960814225 3:121657055-121657077 ATAGATAATAGGGTTGAGGAGGG + Intronic
960887304 3:122409170-122409192 AGGGAAACAAGGGAAGAGGACGG + Intronic
961137369 3:124524287-124524309 AGAGAAAAGTGGGATGAGGAAGG + Intronic
961531377 3:127542366-127542388 ATGGAAGGCAGGGATGAGCATGG + Intergenic
961914334 3:130356038-130356060 ATGCAAAAAAAGGAAGAGGAGGG - Intronic
962803443 3:138909826-138909848 ATGGAGAAGAGAGGGGAGGAAGG + Intergenic
963063351 3:141242450-141242472 AAGGAAAAGAGGGCTGAGCCAGG + Intronic
963529767 3:146460421-146460443 ATGGAAAAGAGAGATGAAATTGG + Intronic
963551005 3:146722747-146722769 ACGGAAAATAGGGAGGATGAGGG - Intergenic
963738398 3:149048535-149048557 ATGGCAAACAGGTTTGAGGATGG + Intronic
963773889 3:149418974-149418996 ATGGGAAAGAAGGATGACAAAGG + Intergenic
963786627 3:149541511-149541533 ATGAAAAAGAGGGAAGCTGAAGG - Intronic
963963701 3:151340889-151340911 CAGGAAATGTGGGATGAGGATGG + Intronic
964028306 3:152105038-152105060 ATGGAAAAGAGGAAGGAAAAGGG - Intergenic
964233542 3:154498418-154498440 CCAGAAAAGAGGGATGAGAAAGG + Intergenic
964384602 3:156133948-156133970 CTGGAAAAAAGTTATGAGGATGG + Intronic
964394437 3:156230938-156230960 AGGGAAAAGAGGGAGGCTGAAGG - Intronic
965743794 3:171904087-171904109 AAGGAAAAGAGAGATGGGGGAGG + Intronic
966203242 3:177378815-177378837 ATGGAAAAGAGGGGAAAGAAAGG + Intergenic
967118798 3:186364525-186364547 AAGGCAAAGAGGGATGGGGCGGG + Intergenic
967303653 3:188040503-188040525 ATGGGCAAGAGGGAAGAGGCAGG + Intergenic
967507200 3:190266016-190266038 ATAGAAAAGGGGAAGGAGGAGGG + Intergenic
968426118 4:524499-524521 GAGAAAGAGAGGGATGAGGAGGG + Intronic
969113751 4:4859314-4859336 GCGGAAAAGAGGGCTGAGGAGGG + Intergenic
969218339 4:5741408-5741430 ATGGAAATGGGGGATGTGGAGGG + Intronic
969403457 4:6972670-6972692 GCGGAAAAGAGGGATGAGGAAGG + Intronic
969737765 4:9002397-9002419 ATGTAAAAGAGGGATGTAGAGGG - Intergenic
969832202 4:9806968-9806990 CTGGAAAAGTGGGCTGAGAAGGG - Intronic
970252100 4:14127332-14127354 ATGGAAGGGAGGGAAGAAGAGGG - Intergenic
970318578 4:14853435-14853457 ATGGAAAAAAGGTGTGGGGAAGG - Intergenic
970377255 4:15471452-15471474 GTGGAAAAAAGGAATGAGGAGGG - Intronic
970415784 4:15855601-15855623 ATGGAGAAGAGGGTAGAGAATGG + Intergenic
970432653 4:16002918-16002940 ATTGAAAAGGAGGAAGAGGAGGG + Intronic
970450177 4:16158447-16158469 ATGGATAAGAAGGGAGAGGAAGG - Intergenic
970457004 4:16234435-16234457 ATGGAAAACTGGGCTGAGGACGG + Intergenic
970674100 4:18429189-18429211 GTGGAAAAAAGGTATGAGGTTGG + Intergenic
970704110 4:18779400-18779422 ATGGAAACCATGGATAAGGAGGG + Intergenic
970737250 4:19187576-19187598 ATGATGAAGATGGATGAGGATGG + Intergenic
970803944 4:20007728-20007750 AGGGAAAGGAGGAATGAGAAGGG + Intergenic
970899175 4:21138825-21138847 ATGGAAAGGAGTCATGAGGCAGG + Intronic
971172799 4:24250608-24250630 AGAGAAAAGAAGGAAGAGGAAGG + Intergenic
971228355 4:24776471-24776493 ATGGACAAGAGGGGATAGGAAGG + Intergenic
971374375 4:26044972-26044994 ATGGGAAAGAGGGGAGTGGATGG - Intergenic
971408258 4:26342520-26342542 ATGGGAGAAAGGAATGAGGAGGG - Intronic
971562979 4:28105223-28105245 AGGGAAAAGATGGATTATGAAGG + Intergenic
971631706 4:29000678-29000700 ATGGTGAAGAGGGAAGATGATGG + Intergenic
971633851 4:29031456-29031478 AGGGAAAAGGAGGAGGAGGAGGG - Intergenic
972179429 4:36445112-36445134 ATGGAATAGGGGGTTGAGTATGG + Intergenic
972286409 4:37652617-37652639 ATGGGAAAGAGGGATGAAAGAGG + Intronic
972801436 4:42479774-42479796 ATGAATAAGAGGGATGGTGATGG + Intronic
973013117 4:45102424-45102446 AAAGAAAAGAGAGAGGAGGAAGG + Intergenic
973128324 4:46617322-46617344 GTGGAAAAGAAGAATGAGGAAGG + Intergenic
973687446 4:53386894-53386916 GTGGAAAAGAGGGGTGATAAAGG + Intronic
973865850 4:55112244-55112266 GAGGAAAAGGGGGAAGAGGAGGG - Intronic
974241035 4:59247467-59247489 AAGGAAAATAGGGAAAAGGAAGG - Intergenic
974407570 4:61495456-61495478 AAGGAAGGGAGGGAGGAGGAAGG + Intronic
974564876 4:63568939-63568961 TTGGGAAAGAGGTATGTGGATGG + Intergenic
974726788 4:65809170-65809192 CTGGAAAACAGGCATGAGAAAGG + Intergenic
974858867 4:67495525-67495547 GTGGAAAAGAGGGATGAGGAAGG + Intronic
974914904 4:68167596-68167618 AGAGAAAGAAGGGATGAGGATGG - Intergenic
975029626 4:69599562-69599584 ATGGAAGAAAGGAAGGAGGAAGG + Intronic
975108728 4:70599592-70599614 ATGGAAGAGAGGAATGTGGTGGG - Exonic
975156076 4:71074586-71074608 AAGGAAAGGAGGGAGGAGGAAGG + Intergenic
975293408 4:72704101-72704123 ATGTAAAAGAAAGATGAGAAAGG + Intergenic
975947082 4:79720059-79720081 ATGGAAAAGCATGAGGAGGAAGG - Intergenic
976005995 4:80431380-80431402 AAGGAAGAGAGGGAGGAAGAAGG - Intronic
976355378 4:84110986-84111008 ATGGAAAAGAGGTAGTGGGAGGG - Intergenic
976957680 4:90922299-90922321 AAGGAGAAGAGGGAAGGGGAAGG + Intronic
977031734 4:91892438-91892460 TTGGGAAAGAGGTATGTGGACGG + Intergenic
977200785 4:94112910-94112932 ATGGAAAAGAGGGAGGGGGAGGG + Intergenic
977578067 4:98695789-98695811 GTGGAAAAGAGATATAAGGAAGG + Intergenic
977613200 4:99058135-99058157 ATGTAGGAGAGGGAAGAGGAGGG + Intronic
977927059 4:102713298-102713320 AGGGAAATGAAGGATGAAGATGG - Intronic
978036132 4:103997459-103997481 AAGGAAGGGAGGGAGGAGGAAGG - Intergenic
978196470 4:105978271-105978293 ATGGAAGAAAGGAAGGAGGAAGG + Intronic
978566666 4:110089855-110089877 AAGGAAAAGAAAGAGGAGGAAGG + Intronic
979001074 4:115220597-115220619 GTGGAAAACAGGGATAAGGAAGG + Intergenic
979028487 4:115608097-115608119 ATGGAAAACAGATATTAGGAAGG - Intergenic
979348546 4:119619004-119619026 ATTGAAAAGAGAAAAGAGGATGG - Intronic
980394784 4:132197602-132197624 ATGGAAATGAGGAATGGGGCTGG + Intergenic
980415093 4:132477175-132477197 ATAGAAAAGAGAGGTGATGATGG - Intergenic
980553755 4:134374882-134374904 ATAGAAAAGGGGGAGAAGGATGG + Intergenic
980807843 4:137836954-137836976 ATTGAAGAGAGGGATCAAGATGG + Intergenic
980879369 4:138693950-138693972 AGGGTAAAGAGGGAGAAGGAGGG + Intergenic
980896913 4:138868934-138868956 AGGGAAAGGAGGGAAGAGGAAGG + Intergenic
981491158 4:145340792-145340814 ATGTTAAATAAGGATGAGGATGG + Intergenic
981637963 4:146902152-146902174 AGGGAAAAGAGGAAGGGGGATGG - Intronic
982160850 4:152568060-152568082 AAGGAAAAGAGGGAGGGAGAGGG - Intergenic
982278636 4:153662261-153662283 ATAGAAAAGAGGGTGAAGGAAGG - Intergenic
982322552 4:154094640-154094662 TTGGAAGAGAGGGATTGGGAGGG - Intergenic
982635055 4:157885405-157885427 AGGGAAAAGAGGGAGGGAGAAGG + Intergenic
982749777 4:159146209-159146231 ATGACTAAGAGGGATGAGAATGG + Intronic
982997923 4:162374839-162374861 ATGGGAAGGAGGGGTAAGGAAGG - Intergenic
983292758 4:165826755-165826777 ATGGAAAATAGGAAGGAGGTGGG - Intergenic
983470939 4:168153343-168153365 GCAGAAAAGAGGGATGGGGAAGG - Intronic
983484408 4:168317416-168317438 ATGGAAAAGAGAAAAAAGGAGGG + Intronic
983612638 4:169666547-169666569 AAGGCAAAGAGGGATGGTGATGG + Intronic
983843279 4:172482748-172482770 GTGGAAAAGATGAATGATGAAGG - Intronic
984418756 4:179492684-179492706 AGGGAAAAGAGAGAAGAGGAAGG - Intergenic
984601572 4:181732982-181733004 AAGGAAAAGAAGGAGGAGAATGG + Intergenic
984692891 4:182748646-182748668 AATGAAAAGAGGGATCAGCATGG - Intronic
984968494 4:185164598-185164620 GCAGAAAAGAGAGATGAGGAAGG - Intronic
985331442 4:188841151-188841173 ATGGAAAAGAGAGATGTGGAGGG + Intergenic
985784994 5:1888753-1888775 GAGGAAAAGAAGGATGAGCAAGG - Intergenic
985895024 5:2743775-2743797 TTGGAAAAGATGAACGAGGAAGG - Intergenic
986071258 5:4286961-4286983 ATGGAAAACAGGAAAGAAGAGGG - Intergenic
986240364 5:5954927-5954949 AGGGGAAAGAGGGAAGGGGAAGG - Intergenic
986463394 5:7996417-7996439 AGGGGAAAGAGTGAAGAGGAAGG - Intergenic
986656724 5:10020186-10020208 TTGTAAAATAGGAATGAGGATGG + Intergenic
986832438 5:11595192-11595214 ATGGGAAAACAGGATGAGGAAGG + Intronic
987225810 5:15840352-15840374 TTGGAAAAGAATGAGGAGGAGGG - Intronic
987297704 5:16568571-16568593 ATGAAATAGATGGATGAGGCCGG - Intronic
987306258 5:16640588-16640610 AGGGAGGGGAGGGATGAGGAGGG + Intergenic
987466172 5:18274900-18274922 TTGGAGAAGAGGTATGTGGATGG - Intergenic
988089602 5:26519532-26519554 AGGGAGAAGAAGGAGGAGGAGGG + Intergenic
988275810 5:29079983-29080005 AAGGAAAAGAGAGAGGAGGGAGG + Intergenic
988731343 5:33976146-33976168 AGGGAATAGAGTGATTAGGAAGG - Intronic
988737832 5:34040404-34040426 AGGGAAAAGAAAGAAGAGGAAGG + Intronic
988947809 5:36224097-36224119 ATGGGGAAGAGAGATGAGTAGGG + Intronic
988994158 5:36698296-36698318 ATGGGAAAGGGTGATGGGGATGG - Intergenic
989238316 5:39175138-39175160 AGGGAAAAGGGGCATGAGGTAGG + Intronic
989306545 5:39964083-39964105 ATAGAAGAGAGAGATGTGGATGG + Intergenic
989308047 5:39980329-39980351 GTGGTAAATAGAGATGAGGAAGG - Intergenic
989333911 5:40291905-40291927 ATTGAAGAGAGGGCTGAGCATGG - Intergenic
989600187 5:43193292-43193314 AGGGAGAAGAGGGAAAAGGAGGG - Exonic
989609015 5:43273662-43273684 CTGGAAAAGCAGAATGAGGAGGG - Intronic
990244249 5:53848207-53848229 ATGGTAAGGAGGGATGTGTAAGG - Intergenic
990247905 5:53881673-53881695 ATGGAATATAGGGAGGCGGAGGG - Intergenic
990513036 5:56506378-56506400 ATGGTAAAAAGGAATCAGGAAGG - Intergenic
990550741 5:56875623-56875645 GTGGAAAAGGAGGATGAGGAAGG - Intronic
990597931 5:57329925-57329947 ATGGGAAGGAGGCAGGAGGATGG - Intergenic
990756693 5:59079827-59079849 AAGGAAAGGAGGGGAGAGGAGGG + Intronic
990805460 5:59655679-59655701 GTGGAAAAGAGGGATGAGGAAGG + Intronic
991261878 5:64676692-64676714 AAGGAAAAGAGGGATGAGGAAGG - Intergenic
991345282 5:65659340-65659362 ATGTAATGGAGGGATGAAGATGG - Intronic
992422641 5:76621972-76621994 ATGGAAAAGAGGGATGAGGAAGG - Intronic
992507861 5:77405890-77405912 ATAGAAAAGAGAGATGAGGCTGG + Intronic
993340376 5:86718249-86718271 ATGGGGAAGAGGGAGGAGGAAGG - Intergenic
993355690 5:86904423-86904445 ATGGAGAAGAGAGGTGATGAAGG - Intergenic
993412491 5:87591186-87591208 TTGGAAAAGAGGTATGTGGATGG - Intergenic
994551878 5:101244567-101244589 ATGGACAAAAGGGTTGAGAATGG + Intergenic
995321508 5:110839637-110839659 AAGGGAAAGAAGGAAGAGGAAGG - Intergenic
996387529 5:122925075-122925097 AAGGAGGAGAGGGAAGAGGAGGG - Intronic
996580760 5:125029626-125029648 ATGGGAAAAAGGGCAGAGGAGGG - Intergenic
996847908 5:127921038-127921060 AAGGAAAGGAGGAAGGAGGAAGG + Intergenic
997833702 5:137175132-137175154 ATGGAAATGAGTTATGAAGAGGG + Intronic
998037772 5:138931302-138931324 AGGGAATAGGGGGATGAAGACGG - Intronic
998365631 5:141629009-141629031 ATGTAACAGAGGAATGGGGAAGG + Intronic
998394727 5:141811468-141811490 AATGAAAAGGGGAATGAGGAAGG - Intergenic
998416527 5:141950228-141950250 ATGGGAGAGAGGGACCAGGATGG - Intronic
998461544 5:142313811-142313833 ATGGAAAAGAGGAAGGGGGGGGG + Exonic
998699384 5:144680355-144680377 AAGGAAATGAAGGATGGGGACGG + Intergenic
998794640 5:145805196-145805218 ATGGAAATAAGGGATGAGGAGGG - Intronic
998811059 5:145966270-145966292 ATGGCAAAGAGGGATGACAGTGG + Intronic
999107129 5:149083647-149083669 ATGAAAAAAAGAGATGAAGAAGG + Intergenic
999233630 5:150077719-150077741 TTGGGAGAGAGGGAGGAGGAGGG - Intronic
999482320 5:151960031-151960053 GTGAAAAAGAGGGATGAGGGAGG + Intergenic
999679670 5:154045056-154045078 AAGGACAAGAGGGATGGGGAAGG - Intronic
999740423 5:154545791-154545813 ATGGGAATGAGGGGTGAGCATGG - Intergenic
999872330 5:155765419-155765441 AAGGGAAAGAGGGAGGAGGGAGG + Intergenic
1000861989 5:166466966-166466988 ATAGAAAAGAGGGCTGGGGACGG - Intergenic
1001121658 5:168985820-168985842 AAGGAAAGGAGGGATGATGGCGG + Intronic
1001132897 5:169079510-169079532 AAGGAGGAGAGGGAGGAGGAAGG + Intronic
1001334947 5:170789367-170789389 TTGGCAATGATGGATGAGGATGG + Intronic
1001546002 5:172570869-172570891 ATGGAAAAAAGGAAGGAGGGAGG + Intergenic
1001594807 5:172891341-172891363 ATGGAGAAGAGGGAAGAGGATGG - Intronic
1001652941 5:173328280-173328302 AAGGAAGAGTGGGAGGAGGAGGG - Exonic
1001685303 5:173590238-173590260 AAGGAAAAGAGAAAAGAGGAAGG + Intergenic
1001817085 5:174678692-174678714 GCCAAAAAGAGGGATGAGGAAGG + Intergenic
1002559837 5:180073612-180073634 ATGGAAGAGAGGGAAATGGAGGG - Intergenic
1002846405 6:949025-949047 ATAGAAAAGAAGGAGGAGGGAGG + Intergenic
1002969138 6:1996155-1996177 ATGAGAAAGAGGAAGGAGGAAGG - Intronic
1003232506 6:4267445-4267467 GAGGAAGAGAGGGAAGAGGAGGG + Intergenic
1003253066 6:4449443-4449465 GTGGAAAAGAAGGATGAGGAAGG + Intergenic
1003384667 6:5656133-5656155 ATGGAAGACAAGGAAGAGGACGG + Intronic
1003413350 6:5885725-5885747 ATGGAAAACGTGCATGAGGAGGG - Intergenic
1003432746 6:6055051-6055073 ATGCAAATGAGGGAGGAGGCAGG - Intergenic
1003441379 6:6145781-6145803 ATGGAAAAGAGAGGAGAGGTTGG + Intronic
1003478264 6:6505246-6505268 AGGGAAGTGAGGGATGGGGATGG + Intergenic
1003961167 6:11210792-11210814 ATAGAAAAGAGAAGTGAGGAAGG + Intronic
1004131177 6:12921538-12921560 AGGGAAAGGAGGAAGGAGGAAGG + Intronic
1004362757 6:14985811-14985833 GTGGCAAATAGGGATGGGGAGGG - Intergenic
1004525575 6:16404402-16404424 AGGGAAAGGTGGGATGAAGAGGG - Intronic
1005091276 6:22059425-22059447 AGGGGAAAGAGGGACGAGAAAGG + Intergenic
1005419260 6:25631912-25631934 GTGCAAAAGAGGGATGACTAGGG + Intergenic
1006284098 6:33080189-33080211 ATGGAAAAGAGAAAGAAGGAAGG + Intronic
1006564421 6:34942834-34942856 AAAGAAAAGAAGGATGGGGAGGG - Intronic
1006597497 6:35204007-35204029 AAGGAAAAGAGAGATGGAGAAGG - Intergenic
1006736626 6:36278093-36278115 ATGGAAAAGAGAGATGGAGTGGG - Intronic
1007038278 6:38698337-38698359 ATGGAAAGGAGGAAGGAAGAAGG - Intronic
1007380858 6:41489162-41489184 AGGGGAAAGGGGGTTGAGGAAGG - Intergenic
1007402166 6:41609007-41609029 AAGCAAGAGAAGGATGAGGAAGG - Intergenic
1007436508 6:41816517-41816539 ATTGAGAAGAGAGCTGAGGATGG - Intronic
1007683230 6:43648835-43648857 AAAGAAAAGAGGGGTGAGAATGG + Intronic
1007897111 6:45374079-45374101 ATGAGAAAGCGGGATGAGGATGG + Intronic
1007995812 6:46306497-46306519 ATGGTAAGGAGAGATGAGGAGGG + Intronic
1008554696 6:52663597-52663619 GCTGAAAAGAGGGATGAGGAAGG + Intergenic
1008652067 6:53573841-53573863 ATTTAAAAGAAGGATGAGGCAGG + Intronic
1008851519 6:56028052-56028074 ATTGAAATGAGGGGTGGGGATGG + Intergenic
1009192961 6:60651704-60651726 GTGGAAAAGAGGGATGAGGAAGG + Intergenic
1009220273 6:60975354-60975376 ATGGAAAACAGAAATTAGGAAGG - Intergenic
1009320346 6:62280340-62280362 AGGGAAATGAAGGATGATGAGGG + Intronic
1009328186 6:62380365-62380387 AGGGGAAAGAGGGATGATGGGGG + Intergenic
1009566551 6:65318248-65318270 CTGGAAAAGAGGAGTGAGAAGGG - Intronic
1009788509 6:68369240-68369262 ATGGGAAAGGGAGATGAGAAGGG + Intergenic
1009856789 6:69274928-69274950 ATCCTAAACAGGGATGAGGAGGG - Intronic
1010374246 6:75148251-75148273 AGGGGCAAGAGGGATGAAGAGGG - Intronic
1010622050 6:78089053-78089075 AGGGAAAATATGGATGAGTAAGG + Intergenic
1010744371 6:79544119-79544141 ACAGAAAAGAGGGATGAGGAAGG - Intergenic
1010989896 6:82468952-82468974 AGGGAAAACAGGAATTAGGAAGG - Intergenic
1011958684 6:93057749-93057771 AAGGAAAAGAGGGATGGGAAGGG + Intergenic
1012271841 6:97222695-97222717 ATGAAAAAGGGGGATGGGGAGGG + Intronic
1012645558 6:101675158-101675180 AGGGAAGAGAGGGATGGAGAGGG - Intronic
1013049404 6:106517624-106517646 GGGGAAAGTAGGGATGAGGATGG - Intronic
1013986890 6:116205136-116205158 GCAGAAAAGAGGGATGAGGAAGG - Intronic
1014354501 6:120388661-120388683 ATGGAAGAAAGGGATGAAAATGG - Intergenic
1014513552 6:122354798-122354820 AGGGAAAAGAGGGGAGGGGAGGG + Intergenic
1014729705 6:125018758-125018780 ATGGTCAAGAGAGGTGAGGAGGG - Intronic
1014814168 6:125917341-125917363 AAGGAAAGCAGTGATGAGGAAGG - Intronic
1014992261 6:128095492-128095514 GTGGAAAAGAGGGATGAGGAAGG + Intronic
1015190192 6:130463976-130463998 ATGGAAGGGAAGGAAGAGGAGGG - Intergenic
1015335109 6:132028002-132028024 GCGGAAGAGAGAGATGAGGAAGG + Intergenic
1015408003 6:132858651-132858673 ATTGATAATAGGGATTAGGAAGG + Intergenic
1015475837 6:133658113-133658135 TTGGAGAAGAGGTATGTGGATGG + Intergenic
1015770907 6:136767382-136767404 AAGGAAGGGAGGGGTGAGGAAGG + Intronic
1016161311 6:140883960-140883982 AGGGAAAAGAGGGAGGAGAAAGG - Intergenic
1016317718 6:142808554-142808576 ATGGAAGAGAGAGATGGGGGAGG + Intronic
1016758595 6:147713896-147713918 TAGGAAGGGAGGGATGAGGAAGG - Intronic
1017229395 6:152056142-152056164 ATGGAAGAAAGTGATGAAGATGG - Intronic
1017275128 6:152557270-152557292 ATGGAAAAAAAGGATGAAAAGGG + Intronic
1017521944 6:155210133-155210155 TTGGAGAAGAGTGCTGAGGATGG + Intronic
1017649134 6:156565021-156565043 ATGGAAAAGAGAGGAGACGAGGG - Intergenic
1017804008 6:157927113-157927135 ATGGAAAACTGGAAAGAGGAAGG + Exonic
1018924285 6:168195531-168195553 ATGGAGCAGGGGGAGGAGGAGGG - Intergenic
1019148896 6:169991252-169991274 AAGGAAAAGAGGGAGGTGGAGGG + Intergenic
1019841509 7:3450808-3450830 AGAGAGAAGAGGGATGAAGATGG + Intronic
1020951208 7:14680068-14680090 ATAGAAAATAAGGCTGAGGATGG + Intronic
1021343426 7:19491458-19491480 TTACAAAAAAGGGATGAGGAGGG - Intergenic
1021807212 7:24369232-24369254 ATAGAAGAGAGGGATTGGGAAGG - Intergenic
1022318518 7:29266274-29266296 ATGAAGAAGAGGGAGGAGGGAGG - Intronic
1022435835 7:30384121-30384143 GCAGAAAAGAGGGATGAGGAAGG - Intronic
1022466507 7:30656030-30656052 ATGGGAAAGAGGGAAAAGGAAGG + Intronic
1022576308 7:31500531-31500553 ATTGAAAAGTGGAATGTGGAAGG - Intergenic
1022627177 7:32049474-32049496 GAATAAAAGAGGGATGAGGAAGG + Intronic
1022633016 7:32103367-32103389 GTGGAAAGTAGGGGTGAGGATGG + Intronic
1022683218 7:32570185-32570207 AAGGAAAACTGGGATGAGCAGGG - Intronic
1022684012 7:32577793-32577815 ATTGAAAAGAAGGCTGAAGAAGG + Intronic
1022816882 7:33922569-33922591 GCAGAAAAGAGGGATGAGGAAGG + Intronic
1022982311 7:35615732-35615754 ATGAAAAGGAGGGATTGGGAAGG - Intergenic
1023093077 7:36634042-36634064 ATGGGAAACAGGGCGGAGGAGGG + Intronic
1023214112 7:37842667-37842689 ATGGAAATGTAGGATGAGTATGG - Intronic
1023218418 7:37891699-37891721 GCAGAAAAGAAGGATGAGGAAGG - Intronic
1023706376 7:42945948-42945970 GCAGAAAAGAGGGATGAGGAAGG + Intronic
1023740552 7:43277448-43277470 GCAGATAAGAGGGATGAGGAAGG + Intronic
1023809687 7:43902159-43902181 ATGGTGGAGAGGGAGGAGGAGGG + Intronic
1024157614 7:46640592-46640614 ATGGGAAGGATGGCTGAGGAGGG + Intergenic
1024602722 7:50998649-50998671 AGGGCAAAGAGGGCTGTGGAAGG + Intergenic
1024800159 7:53067880-53067902 TTGAAAAAAAAGGATGAGGATGG + Intergenic
1024806511 7:53147815-53147837 GTGGAAAAGAGGGATGAGGAAGG - Intergenic
1024924390 7:54598035-54598057 GCGGAAAAAATGGATGAGGAAGG - Intergenic
1025096669 7:56100998-56101020 GTGGAAAAGAGCGATGAGGAAGG - Intergenic
1025116015 7:56258915-56258937 AAGGAAGTGAGGGAGGAGGAAGG - Intergenic
1025121372 7:56306841-56306863 GTGGAAAAAAGGGATAAGGAAGG + Intergenic
1026040684 7:66865735-66865757 AGGGAAAAAAGGGAAGAGAAGGG - Intergenic
1026044203 7:66894573-66894595 AGGGAAGAGAGGGAGGAGGAAGG + Intergenic
1026501543 7:70947188-70947210 AAGAAAAGGAGGGAAGAGGACGG - Intergenic
1026588900 7:71679921-71679943 AAGGGAGAGAGGGAGGAGGAAGG - Intronic
1026588953 7:71680076-71680098 AAGGGAGAGAGGGAGGAGGAAGG - Intronic
1026593140 7:71713309-71713331 ATGGGGACGAGGGATGAGAAGGG + Exonic
1026632402 7:72048781-72048803 AAGGAAAAAAGGAAGGAGGAAGG - Intronic
1026800617 7:73397785-73397807 AAGGAGAAGGGGGAGGAGGAGGG + Intergenic
1026840812 7:73669035-73669057 ATGGAAAATGGGGCAGAGGAGGG + Intronic
1027140149 7:75650943-75650965 AGGGAGAAGAGGGAAGAGAAAGG + Intronic
1027236340 7:76300275-76300297 ATTGAAGAGAGGGAAAAGGAAGG - Intergenic
1027303946 7:76872525-76872547 ATGCAGATGAGAGATGAGGAAGG + Intergenic
1027675462 7:81152515-81152537 AGGGAAAGGAGAGAAGAGGAGGG + Intergenic
1028114257 7:86979895-86979917 GTGGAAAAAAGAGATGAGAAAGG - Intronic
1028237913 7:88383452-88383474 TTGGAGAAGAGGTATGTGGATGG + Intergenic
1028396326 7:90372604-90372626 ATGGAAAATATGGCTGGGGAGGG - Intronic
1029220863 7:98989234-98989256 ACGAAACAGAGGGCTGAGGAGGG + Intronic
1029354377 7:100040647-100040669 AAGGAGAAGGGGGAAGAGGACGG + Exonic
1029423678 7:100484153-100484175 ATGGAGAAGGGGGATGAAGCAGG + Intronic
1029600057 7:101558181-101558203 GTGGGGAAGGGGGATGAGGAAGG - Exonic
1029630473 7:101747228-101747250 GCGGAAAAGAGGGATGAGGAAGG - Intergenic
1030608004 7:111659149-111659171 TGGGAAAATAGGGAAGAGGAAGG - Intergenic
1031072668 7:117179634-117179656 TTAGAGCAGAGGGATGAGGAGGG + Intronic
1031097513 7:117438537-117438559 AAGGAAAAGAAGGTTGAGAATGG + Intergenic
1031778224 7:125928637-125928659 ATGCAAAACAGGGCTGAGAATGG - Intergenic
1031917743 7:127578917-127578939 GGGGAAAAGGGGGATGAGGGGGG + Intergenic
1032165214 7:129539922-129539944 ATAGGAGAGAGGGATGAGGAGGG + Intergenic
1032199299 7:129808127-129808149 ATAGAGAAGAGGGAAGGGGAGGG - Intergenic
1032217497 7:129968970-129968992 ATGGAAAAGAGAGAGGAGGCCGG + Intergenic
1032746312 7:134790130-134790152 AGGGAAAAGGGGGAAGAGGAGGG + Intronic
1033148039 7:138887958-138887980 AAGGAGAACAGGGAAGAGGACGG + Intronic
1033683407 7:143618720-143618742 GGGGAAAAGAGGGATGAGGAAGG + Intergenic
1033701206 7:143838918-143838940 GGGGAAAAGAGGGATGAGGAAGG - Intergenic
1033733995 7:144204553-144204575 TTGGAAGATAGGGATGGGGATGG + Intergenic
1033749056 7:144346420-144346442 TTGGAAGATAGGGATGGGGATGG - Intergenic
1033890419 7:146006369-146006391 AAGGAAGAGGGGGAGGAGGAGGG - Intergenic
1033912738 7:146285669-146285691 AGGGAGATGAGGGAAGAGGAGGG - Intronic
1034997024 7:155584065-155584087 ATCCAGAAGAGGGAGGAGGATGG - Intergenic
1035688755 8:1546453-1546475 ATGGAAACATGGGATAAGGAAGG - Intronic
1035775564 8:2185065-2185087 AGGGAAAAGAGGGAAGAGGCAGG + Intergenic
1035898468 8:3431504-3431526 CTGGAAAAAAGGCATGGGGATGG - Intronic
1035913416 8:3594121-3594143 ATGGAAAAGAGTGAAGAGTGAGG - Intronic
1036130398 8:6104263-6104285 ATGGAGAGGAGGGGAGAGGAAGG + Intergenic
1036962933 8:13265728-13265750 AAGGAAAGGAGGGAAGGGGAGGG - Intronic
1037218336 8:16485295-16485317 ATGGAAATGGTGGATGAGGTGGG - Intronic
1037227391 8:16609539-16609561 AAGGAACAGAAGGAAGAGGAGGG + Intergenic
1037631070 8:20656873-20656895 TTGGATAAGAAGGGTGAGGAGGG - Intergenic
1037674127 8:21039690-21039712 AAGGGAAAGATGGATGGGGATGG - Intergenic
1037802368 8:22042754-22042776 AGAGAAAAGAGGGAGGAGGAGGG - Exonic
1037927411 8:22854849-22854871 TTTGAAAAGAGGGAGGGGGAGGG - Intronic
1038626425 8:29197676-29197698 GCAGAAAAGAAGGATGAGGAAGG - Intronic
1038644698 8:29351876-29351898 ATGCAAAAGAGAAATGGGGATGG - Intergenic
1039104028 8:33970915-33970937 ATGGACAGGAGGCATGAGGGTGG - Intergenic
1039324087 8:36465916-36465938 TTGGAGAAGAGGTATGTGGATGG - Intergenic
1039326662 8:36492749-36492771 AAGGTAGAGAGGGAGGAGGAAGG - Intergenic
1039424906 8:37477692-37477714 ATGGATAAGAGGGAGGGTGAGGG - Intergenic
1039468788 8:37801270-37801292 GTGGGACAGAGGGATCAGGAAGG - Intronic
1039600530 8:38833243-38833265 GCGGAAAAGAGGGATGAGGAAGG + Intronic
1040384288 8:46903185-46903207 AGAGAAAAGAGGGAGGAGGGTGG + Intergenic
1040576303 8:48654382-48654404 ATGGAAGAGAGGAAGAAGGAAGG - Intergenic
1040675869 8:49749559-49749581 AAGGAAAGGAGGGGGGAGGAAGG + Intergenic
1041572512 8:59353248-59353270 GTGGAAAAGTGGAATGAGAAGGG + Intergenic
1041884480 8:62792662-62792684 AAGGAAAAGTGGATTGAGGAAGG + Intronic
1042317803 8:67442989-67443011 AGGGAAAAGAAGGATGGGGCTGG - Intronic
1042708763 8:71691494-71691516 GCAGAAAAGAGGGATGAGGAAGG - Intergenic
1042984543 8:74568403-74568425 CTGGAAAAGAGGGATGAGGAAGG - Intergenic
1043243489 8:77967407-77967429 ATGGAAAAGAGGTGGGAGGAGGG + Intergenic
1043379557 8:79687996-79688018 GCAGAAAAGAGGGATGAGGAAGG - Intergenic
1043544726 8:81302419-81302441 ATGGAGAGGTGGGTTGAGGAGGG - Intergenic
1043800099 8:84598133-84598155 ATGATAAAGAGGGAGGAGTAAGG - Intronic
1044011754 8:87002712-87002734 AAGGGTAAGAGGGATGAAGAAGG - Intronic
1044150882 8:88773702-88773724 ATAGGAAAGAGGTATGTGGATGG + Intergenic
1044165187 8:88973721-88973743 ATTGAAAAGCGGCATGAGCAGGG + Intergenic
1044252009 8:90013966-90013988 ATGTAGGAGAGGGATGAGTATGG + Intronic
1044285887 8:90411817-90411839 TTGGGGAAGAGGTATGAGGATGG - Intergenic
1044381514 8:91539618-91539640 GGGGAAAAGAGAGATGAGGGAGG - Intergenic
1044425714 8:92047397-92047419 ATGGAAAATCAGGATAAGGAGGG - Intronic
1044822974 8:96170125-96170147 AATGAAAAGAGGGAGGAAGATGG - Intergenic
1045015069 8:97994240-97994262 AAGGGAAAGAGGGAGGAGGAGGG + Intronic
1045130393 8:99145462-99145484 CTGGAAAAGAGGGAGGAGAAAGG - Intronic
1045722820 8:105133736-105133758 AGGGAAAAGTGGGAAGGGGAAGG - Intronic
1045744913 8:105406966-105406988 ATAGAACAGTGGAATGAGGAAGG + Intronic
1046362897 8:113185420-113185442 CTGGGAAAGAGGGATGGGGAAGG - Intronic
1046808255 8:118504084-118504106 CAGGAAAAGAGGGAAGAGTAAGG - Intronic
1047190063 8:122670387-122670409 AAGGAAAAGAAGCAAGAGGAAGG + Intergenic
1047389290 8:124437118-124437140 GGGGAAATGAGGGATGAGAAAGG + Intergenic
1047398399 8:124524913-124524935 GGGGAAATGAGGGATGAGAAAGG + Intronic
1047556358 8:125935416-125935438 ATAGTAAAGATGGATGATGATGG - Intergenic
1047572264 8:126111867-126111889 ATGGGCAAGAGGGAGGAGGAAGG - Intergenic
1047632671 8:126725452-126725474 CTGGAGAAGAGGCATGAGAATGG - Intergenic
1047880170 8:129184262-129184284 ATGGAAAACAGGGCTGGGCATGG + Intergenic
1048032570 8:130646458-130646480 GAGGAAATGAGGCATGAGGAAGG - Intergenic
1048262796 8:132959920-132959942 GCAGAAAAGAGTGATGAGGAAGG + Intronic
1048437907 8:134434766-134434788 AGGGGAAGGAGGGATGAGGTGGG - Intergenic
1049018076 8:139935539-139935561 ATAAAAAAGAGAGAAGAGGATGG + Intronic
1049169215 8:141148237-141148259 GTGGAAAGGAGGGAGGAGGGAGG + Intronic
1049361095 8:142212919-142212941 ATGGGAGAGAGGGAGGGGGAGGG - Intronic
1049405120 8:142448963-142448985 AGGGAAGAGATGGGTGAGGATGG - Intergenic
1049405126 8:142448990-142449012 AGGGAAGAGATGGGTGAGGATGG - Intergenic
1049832465 8:144710778-144710800 TTGGGGAAGAGGGATGAGGAAGG + Intergenic
1050475918 9:6040989-6041011 AAGGAAAAGAGGAAGAAGGAAGG - Intergenic
1050588797 9:7141250-7141272 TGGGAAAAGAGGGATGAGAAAGG - Intergenic
1051241949 9:15066755-15066777 AAGGCAAAGAGGGATGGTGATGG - Intergenic
1051370962 9:16358684-16358706 GCAGAAAAGAGGGATGAGGAAGG - Intergenic
1051388688 9:16539722-16539744 AAGGAAAAGAGGGAAAGGGAAGG + Intronic
1051432046 9:16989325-16989347 ATGATGAAGAGGAATGAGGAAGG - Intergenic
1051553714 9:18359266-18359288 ATGGAAAAGATGGAGGCTGAAGG - Intergenic
1051627476 9:19112069-19112091 ATGGAAGTGAGTGTTGAGGATGG - Intronic
1052531180 9:29686289-29686311 AAGGAAGAGAAGGAGGAGGAGGG + Intergenic
1052692985 9:31838773-31838795 ATGGTAGAGAGTGAGGAGGAAGG + Intergenic
1053329277 9:37188732-37188754 GGGGAAGAGAGGGGTGAGGAAGG - Intronic
1054723161 9:68623788-68623810 GTGGAGAAGGGGGAAGAGGAAGG + Intergenic
1054936254 9:70691930-70691952 GAGGAAAAGAGGGATGAGGAAGG - Intronic
1055078876 9:72246941-72246963 GCAGAAAAGAGGGATGAGGGAGG - Intronic
1055316551 9:75039837-75039859 GGGGAAGAGAGGGAAGAGGAAGG - Intergenic
1055660898 9:78502957-78502979 CTGGAAAAAAGGGCTGTGGAGGG + Intergenic
1055716407 9:79122756-79122778 AAGGAGAAGAAGGAGGAGGAGGG + Intergenic
1056120229 9:83480325-83480347 ATGGAAACCAGGGATATGGAGGG - Intronic
1056239742 9:84632567-84632589 ATAGCAAAGGGAGATGAGGAGGG - Intergenic
1056298982 9:85222320-85222342 ATGTAAAACAGGGATGTTGATGG + Intergenic
1056497454 9:87173217-87173239 AAAGAAAAGAGTGATGATGAGGG + Intergenic
1056513353 9:87327100-87327122 AGGAAGAAGAAGGATGAGGAGGG + Intergenic
1056701759 9:88917120-88917142 GTGGAAAAGAGGGACGAGGAAGG - Intergenic
1056743989 9:89284051-89284073 ATGGAAAAGGAGGTTGAGAAGGG - Intergenic
1056832208 9:89926217-89926239 ATACAAGAGAGAGATGAGGAAGG + Intergenic
1056893933 9:90523305-90523327 ATGGAACAGAGGAAAGAGGCTGG - Intergenic
1057185543 9:93055642-93055664 ATGGAGAAGGAGGGTGAGGAAGG + Intergenic
1058195975 9:101976362-101976384 ATGTTAAAGAGGGAGGAGAAGGG + Intergenic
1058273371 9:103005349-103005371 GATGAAAAGAAGGATGAGGATGG + Exonic
1058349399 9:104003421-104003443 GTGGAAAAGGGAGAAGAGGAAGG + Intergenic
1058719085 9:107747341-107747363 ATGAGAAAGGAGGATGAGGAGGG + Intergenic
1058961424 9:109995900-109995922 ATGGAGAGGAAGGATGAGGCAGG + Intronic
1059354234 9:113687092-113687114 GAGGAAAGGAGGGAGGAGGAGGG + Intergenic
1059382921 9:113942324-113942346 AAAGAAGAGAGGGAAGAGGAAGG - Intronic
1059646733 9:116275624-116275646 AGGAAAAAGGGGGAAGAGGAAGG - Intronic
1059799617 9:117737061-117737083 ATGGAAAAGAGGAATGTCAAGGG - Intergenic
1059813215 9:117880685-117880707 ATGAAAAAAAGCCATGAGGAGGG - Intergenic
1059823204 9:117997116-117997138 GAGGAAAAGAGGAAGGAGGAAGG - Intergenic
1059986026 9:119821484-119821506 ATGAAAATAAAGGATGAGGAAGG - Intergenic
1060020743 9:120128677-120128699 ATTTAAAAGAGGCATCAGGAAGG + Intergenic
1060194269 9:121613052-121613074 AGGAAACAGAGGGATGTGGAAGG + Intronic
1060278585 9:122200507-122200529 GCAGAAAAGAGGGATGAGGAAGG - Intergenic
1060735728 9:126065542-126065564 AGGGAAAGGAGGGAGGGGGAGGG - Intergenic
1061216791 9:129226264-129226286 AGGGGAAAGAGGGAGAAGGAGGG + Intergenic
1061255672 9:129453395-129453417 ATGGAGTAGAGGGATGGGGATGG + Intergenic
1061370146 9:130193363-130193385 ATGGGAAAGTGGGATGGGGTGGG + Intronic
1061530978 9:131212600-131212622 AAGTAACAGAGGGCTGAGGATGG - Intronic
1061619661 9:131803641-131803663 ATGGACCAGAGGTAGGAGGAGGG + Intergenic
1061726511 9:132584854-132584876 ATGGAGAAGGGGGAGGAGGAAGG + Intronic
1062154774 9:135040922-135040944 AGGGAAGAGAGGGATGAAGGAGG - Intergenic
1062275229 9:135727335-135727357 ATGGGAAAGAGGGAGAAAGAGGG - Intronic
1185499333 X:585095-585117 GTGGAGAAGGGGGAGGAGGAGGG + Intergenic
1185913542 X:4009017-4009039 GTGGAAAAGAGAGATAAGGAAGG + Intergenic
1185928742 X:4176308-4176330 ATGGGAATGGGGGATGAGGGAGG + Intergenic
1186077588 X:5897932-5897954 AAGGAAAACAGGGAAAAGGAGGG - Intronic
1186268014 X:7852497-7852519 GAAGAAAAGAGGGATGAGAAGGG + Intergenic
1186386019 X:9110855-9110877 ATGGAAAACATGGATGATGACGG + Intronic
1187264418 X:17718373-17718395 AAGGAAGAGAGGGAAGAAGAAGG + Intronic
1187266872 X:17741735-17741757 GTGGAAAAGAGGGATGAGGAAGG + Intronic
1187616496 X:21000397-21000419 AGAGAAAATAGGGAAGAGGAAGG - Intergenic
1187783871 X:22862157-22862179 AGGGAAAAGAGGAAGGGGGAAGG + Intergenic
1187973275 X:24679949-24679971 ATGGAGAAGAGGAAAGGGGAAGG - Intergenic
1189141962 X:38616532-38616554 GCGGAAAAGAGGGATGAGGAAGG - Intronic
1189246763 X:39569275-39569297 AAGGAAAAGAGAGAGGAGGGAGG - Intergenic
1189286099 X:39853580-39853602 ATGGAAAGGGGGGAAGAGGAGGG + Intergenic
1189321167 X:40088457-40088479 GGGAAAAAGAGGGAGGAGGAGGG + Intronic
1189450359 X:41123108-41123130 AAGGACAAGAGGTATGAGGGTGG - Intronic
1189585857 X:42461075-42461097 AATGAAAACTGGGATGAGGAAGG + Intergenic
1189778719 X:44493530-44493552 ATGGCAGACAGGGATGAGGTTGG + Intergenic
1189783765 X:44541706-44541728 AATCAAAAGAAGGATGAGGAGGG + Intronic
1190166860 X:48080455-48080477 ATGGGAAGTAGGGATGAGCAGGG - Intergenic
1190716843 X:53111745-53111767 GCAGAAAAGAGGGATGAGGAAGG - Intergenic
1190936821 X:55005223-55005245 ATGCATAAGAGGAATGAGGCAGG - Intronic
1190996666 X:55616856-55616878 TTGGAGAAGAGGTATGTGGATGG - Intergenic
1191880639 X:65841205-65841227 ATGGGTATGAGGGAAGAGGATGG + Intergenic
1192130117 X:68541900-68541922 ATGGAAAAGTGGGGTGTGGAGGG - Intergenic
1192678435 X:73225290-73225312 ATGGAGAACAGGGATGGGAAAGG + Intergenic
1192747180 X:73950825-73950847 GTGGAAAAGATGGAGGAGGCAGG + Intergenic
1192796953 X:74431893-74431915 ATGGAAAAGATGGAGTGGGAAGG - Intronic
1192838493 X:74828062-74828084 ATGGAAACAAGGGATGAAGATGG + Intronic
1193414258 X:81202376-81202398 AGGGAAAAAAGGGAAGAAGAAGG - Intronic
1193911706 X:87314634-87314656 AGGTAAAATAGGGAGGAGGAAGG - Intergenic
1195013469 X:100755574-100755596 ATGGGGAAGAGGTATGTGGATGG - Intergenic
1195100364 X:101549896-101549918 ATTGAAAAGTGGGCTGAGGTGGG - Intergenic
1195316962 X:103688352-103688374 AAAGAAAAGAGGGATGGAGAGGG - Intergenic
1195782267 X:108479237-108479259 TTGGGAAAGAGGTATGTGGATGG - Intronic
1195866666 X:109439760-109439782 ATGGAAATGAGGAATGAAGTTGG - Intronic
1196005886 X:110836761-110836783 ATGAAAAAGAGGAATGAGGAGGG + Intergenic
1196295649 X:113993898-113993920 ATGGAAAAGAACGAAAAGGAGGG - Intergenic
1196397508 X:115280878-115280900 GCAGAAAAGAGGGATGAGGAAGG + Intergenic
1196404861 X:115350485-115350507 ATGAGAAAGAGAGAGGAGGAAGG + Intergenic
1197105481 X:122708798-122708820 TTGGATAAGAGTGATGAGTATGG - Intergenic
1197165053 X:123368075-123368097 ATGGAATATAGGGAGGAGGCTGG + Intronic
1197174434 X:123470206-123470228 AAGGAAATGAGGGAGGAGGATGG + Intronic
1197591956 X:128420012-128420034 ATGGGGAAGAGGTATGTGGATGG + Intergenic
1197636021 X:128915633-128915655 AAGGAAAAGACAGAAGAGGAGGG + Intergenic
1197867867 X:131037652-131037674 AAGGAAAAGGGGAATGAGAAAGG - Intergenic
1197997395 X:132392739-132392761 ATGGTGAAGAGGAAAGAGGAAGG - Intronic
1198367000 X:135951218-135951240 CTGGAAACGAAGGATGAGGAAGG - Intergenic
1198806551 X:140500668-140500690 ATGTAAAACAAGGAAGAGGAGGG + Intergenic
1198975938 X:142335620-142335642 ATGGAAAAAAGGCACAAGGAAGG + Intergenic
1199712044 X:150476565-150476587 ATGGGGAGGAGGGATGTGGATGG + Intronic
1199755635 X:150862369-150862391 AAGTAAAACAGGGATGAGGGAGG + Intronic
1199879384 X:151961133-151961155 AAGGAAATGAGGGTGGAGGATGG + Intronic
1199907737 X:152251565-152251587 ATGGAAGAGAAGCAAGAGGAAGG - Intronic
1200103674 X:153700935-153700957 ATGGACAAGAAGGAAGAGTAAGG - Exonic
1200304975 X:155015656-155015678 AGAGGAAAGAGGGAGGAGGAAGG + Intronic
1200887909 Y:8288885-8288907 AGGGAAGGTAGGGATGAGGAAGG + Intergenic
1201300187 Y:12498531-12498553 AGGGAAGAGAGGGAGGAGGAAGG - Intergenic