ID: 1125430421

View in Genome Browser
Species Human (GRCh38)
Location 15:39588189-39588211
Sequence GGCGTCTTTCTTGCAGGCTT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 119}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125430421_1125430428 8 Left 1125430421 15:39588189-39588211 CCAAAGCCTGCAAGAAAGACGCC 0: 1
1: 0
2: 0
3: 9
4: 119
Right 1125430428 15:39588220-39588242 TAAGTGTGAGGTCCGCTGCAAGG 0: 1
1: 0
2: 1
3: 7
4: 61
1125430421_1125430423 -4 Left 1125430421 15:39588189-39588211 CCAAAGCCTGCAAGAAAGACGCC 0: 1
1: 0
2: 0
3: 9
4: 119
Right 1125430423 15:39588208-39588230 CGCCTGCCCCAGTAAGTGTGAGG 0: 1
1: 0
2: 0
3: 10
4: 155
1125430421_1125430430 18 Left 1125430421 15:39588189-39588211 CCAAAGCCTGCAAGAAAGACGCC 0: 1
1: 0
2: 0
3: 9
4: 119
Right 1125430430 15:39588230-39588252 GTCCGCTGCAAGGGTGAGCATGG 0: 1
1: 0
2: 0
3: 5
4: 94
1125430421_1125430431 19 Left 1125430421 15:39588189-39588211 CCAAAGCCTGCAAGAAAGACGCC 0: 1
1: 0
2: 0
3: 9
4: 119
Right 1125430431 15:39588231-39588253 TCCGCTGCAAGGGTGAGCATGGG 0: 1
1: 0
2: 0
3: 7
4: 59
1125430421_1125430429 9 Left 1125430421 15:39588189-39588211 CCAAAGCCTGCAAGAAAGACGCC 0: 1
1: 0
2: 0
3: 9
4: 119
Right 1125430429 15:39588221-39588243 AAGTGTGAGGTCCGCTGCAAGGG 0: 1
1: 0
2: 0
3: 4
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125430421 Original CRISPR GGCGTCTTTCTTGCAGGCTT TGG (reversed) Exonic
907020048 1:51058855-51058877 TGCGTATTTCTTGTAGCCTTGGG + Intergenic
907074761 1:51568125-51568147 GGATTCTTTCTTCCAGGCTCTGG - Intergenic
908368500 1:63454467-63454489 GATGACTTTCTTGTAGGCTTTGG - Exonic
908657340 1:66402203-66402225 GGAGTCCTTCTTGCAGGTCTAGG - Intergenic
909091651 1:71233296-71233318 GAAGTCTTTCTCCCAGGCTTTGG - Intergenic
913592320 1:120341394-120341416 GGAGGCGTGCTTGCAGGCTTCGG + Intergenic
914170075 1:145215316-145215338 GGAGGCGTGCTTGCAGGCTTCGG + Intergenic
914525194 1:148459279-148459301 GGAGGCGTGCTTGCAGGCTTCGG + Intergenic
914598484 1:149176551-149176573 GGAGGCGTGCTTGCAGGCTTCGG - Intergenic
914641210 1:149607855-149607877 GGAGGCGTGCTTGCAGGCTTCGG - Intergenic
914667491 1:149843097-149843119 GCCGTCTTTCTTCTGGGCTTTGG - Intronic
914668276 1:149850693-149850715 GCCGTCTTTCTTCTGGGCTTTGG + Intronic
914673039 1:149886560-149886582 GCCGTCTTTCTTCTGGGCTTTGG + Exonic
917796551 1:178537087-178537109 GGCTTCTATGCTGCAGGCTTTGG + Intronic
919889859 1:201963376-201963398 GGCTTATTTCTTATAGGCTTTGG + Intronic
921325447 1:213983237-213983259 GGCGTATTCCTCGCAGGATTCGG + Intronic
922905312 1:229169470-229169492 TGTGTCTTTCTTGCAGGCATTGG - Intergenic
923250431 1:232175556-232175578 TTGGTCTTCCTTGCAGGCTTTGG + Intergenic
1063131647 10:3183215-3183237 TGTGTTTTTCTTGCAGCCTTAGG + Intergenic
1063725604 10:8634334-8634356 CCCATCTTTCATGCAGGCTTAGG - Intergenic
1069579558 10:69556281-69556303 GGAGTCTGTCCTGTAGGCTTTGG - Intergenic
1069994866 10:72335974-72335996 GCAGGCTTCCTTGCAGGCTTCGG - Intronic
1074379078 10:112963889-112963911 GGCGGCTTTCTGGCAGTGTTTGG + Intronic
1075536380 10:123275474-123275496 GGCTTCCTGCTTGCAGGTTTGGG - Intergenic
1076216656 10:128699935-128699957 GGGGTCTGGCTTGCAGGCGTCGG - Intergenic
1082904700 11:58293076-58293098 GGAGTCTTTCTTGCTTGCTCAGG + Intergenic
1084538337 11:69771629-69771651 GTCTTCTTTCTTCCAGGCCTTGG + Exonic
1085280964 11:75330412-75330434 GGGCTCTTTCCTGCAGCCTTTGG - Intronic
1094361406 12:29635207-29635229 GCCGTTTATCTTTCAGGCTTGGG + Intronic
1095309004 12:40673441-40673463 GAAGTCTTTCTTCCAGGATTTGG + Intergenic
1096798928 12:54096612-54096634 GCCGTGTTTCCTGCTGGCTTTGG + Intergenic
1099313646 12:81058809-81058831 GTTGTGTTTCTTCCAGGCTTTGG + Intronic
1099810965 12:87581805-87581827 AGCATCTTTCTTGCAGCTTTTGG - Intergenic
1100192296 12:92205701-92205723 GGATTCTTTCCTGAAGGCTTTGG - Intergenic
1100783925 12:98059084-98059106 GGCGACTTTCTTGCATGACTTGG - Intergenic
1102522600 12:113487977-113487999 GGCTTCTTTTTCTCAGGCTTTGG + Intergenic
1105268073 13:18839984-18840006 GGAGTATTTCTTGCAGTCTTCGG + Intergenic
1107415187 13:40193452-40193474 GGCCTCTTTCTTTCAGGCTCAGG - Intergenic
1108574186 13:51777294-51777316 GGCATCTTTCTTCCAGTCCTGGG - Intronic
1112817528 13:103290691-103290713 GGAGTCTCTCTTCCAGACTTCGG - Intergenic
1114580954 14:23759174-23759196 GTCGTGTCTCTTCCAGGCTTTGG + Intergenic
1117442786 14:55775486-55775508 GGCGTTTTGCTGGCAGTCTTTGG + Intergenic
1121101157 14:91251282-91251304 GCAGTCTTTCTTGCAGGGCTTGG - Exonic
1202831217 14_GL000009v2_random:33984-34006 GGAGTATTTCTTGTAGTCTTCGG - Intergenic
1125430421 15:39588189-39588211 GGCGTCTTTCTTGCAGGCTTTGG - Exonic
1128146477 15:65334859-65334881 GGCGTCTTCCTCCCAGGCTCGGG - Exonic
1128721947 15:69956566-69956588 GGCGTCTGTCTTGGAGCATTTGG - Intergenic
1130222615 15:82033259-82033281 GGGGTGTGTCTTGCAGGCATTGG - Intergenic
1132138633 15:99369538-99369560 GGATTCTTTATTGCAGTCTTAGG + Intronic
1135171940 16:20192304-20192326 GAAGTCTTCCTTCCAGGCTTTGG - Intergenic
1144759834 17:17701028-17701050 GGGGTCTTTGTTGCAGGCAGAGG - Intronic
1145854988 17:28146625-28146647 GGTGTGTTTGTTGTAGGCTTTGG - Intronic
1148849492 17:50547897-50547919 GGCATCTCTCTGGCAGGCCTGGG - Intronic
1151315072 17:73316912-73316934 AGCCTCTCTCTTGCAGGCATGGG - Intergenic
1151618390 17:75229811-75229833 GGTGGCTTTCGTGCAGGCTAAGG + Intronic
1151644044 17:75417452-75417474 TGCTTCTTTCTTGTAGGCGTAGG - Intergenic
1154312021 18:13274175-13274197 GCCTTCTTTCTTGGAGGCCTGGG + Intronic
1154419946 18:14220063-14220085 GGAGTATTTCTTGCAGTCTTTGG - Intergenic
1157551119 18:48582471-48582493 GGCGTCTTTGTTGCCTGCATAGG + Intronic
1164801408 19:31079830-31079852 GGGGTCTTTCTAGATGGCTTTGG - Intergenic
1165126541 19:33601969-33601991 GGGGTCTGTCTTGGATGCTTAGG - Intergenic
929555756 2:42924737-42924759 CCCGCTTTTCTTGCAGGCTTTGG + Intergenic
933410489 2:81919094-81919116 GTTGTGTTTCTTCCAGGCTTTGG + Intergenic
938077403 2:128347020-128347042 GGCGGCTTCCTCTCAGGCTTGGG - Intergenic
939709076 2:145492668-145492690 GTGGTCTTTTGTGCAGGCTTTGG - Intergenic
940019483 2:149141877-149141899 GGTGGCTTGCTTGCAGTCTTTGG + Intronic
941539981 2:166770355-166770377 GGTGTGTTTCTTCCAGGTTTTGG + Intergenic
941863412 2:170308776-170308798 GTTGTCTTTCTTGAAGGCTGGGG - Intronic
947162498 2:227228351-227228373 GGCGTCTGTCTGGCACGGTTTGG + Intronic
947194584 2:227548411-227548433 GGCATCTTTGTTGCAGACTGAGG + Intronic
948840412 2:240645972-240645994 GGTGCCTTCCTGGCAGGCTTTGG - Intergenic
948858560 2:240742009-240742031 CAGGTCTTTCTTGCAGGCTGTGG + Intronic
1169320403 20:4627860-4627882 GAGGTCTTTCTTGCAGCATTTGG - Intergenic
1170724738 20:18916420-18916442 TGTGTCTTTCTTCCAGGCATAGG + Intergenic
1171797494 20:29577738-29577760 GCCGTGTTTCCTGCTGGCTTTGG - Intergenic
1171888592 20:30683986-30684008 GGAGTATTTCTTGCAGTCTTCGG + Intergenic
1176610405 21:8878814-8878836 GGAGTATTTCTTGTAGTCTTCGG - Intergenic
1176853346 21:13939253-13939275 GGAGTATTTCTTGCAGTCTTCGG + Intergenic
1176869377 21:14073598-14073620 GGGGGCTTTCTTGCAGCTTTGGG + Intergenic
949377980 3:3411007-3411029 GTTGTGTCTCTTGCAGGCTTTGG - Intergenic
950753302 3:15149030-15149052 GGCCTCTTTCTTCCATGCCTGGG - Intergenic
951940792 3:28076615-28076637 ACCGTCTTTCTTACAGGCTTAGG - Intergenic
953847035 3:46435879-46435901 CTCCTCTTTCTTGCAGTCTTGGG - Exonic
957271471 3:78035916-78035938 GGGGTCTTTCTTGCTCTCTTGGG - Intergenic
959159298 3:102704460-102704482 GGCTTCTCTCTTCCAGGCTCAGG - Intergenic
967424060 3:189305857-189305879 TGCCTCTTTCTGGGAGGCTTTGG + Intronic
1202737085 3_GL000221v1_random:13596-13618 GGAGTATTTCTTGTAGTCTTCGG - Intergenic
972845733 4:42986870-42986892 GGCTTCTTCTTTCCAGGCTTAGG - Intronic
975731360 4:77340528-77340550 GTCGTGTTTCTGCCAGGCTTTGG + Intronic
981794029 4:148574709-148574731 GGAGTCTTGCTTGAAGGGTTGGG + Intergenic
984542867 4:181061940-181061962 GGTGACTTTCTTTCATGCTTTGG + Intergenic
988568103 5:32336778-32336800 AGGGTCTTTCTTGCAATCTTTGG + Intergenic
990048725 5:51468435-51468457 GGGGTCTGTCTTGCATGCTCTGG + Intergenic
993745679 5:91594003-91594025 TTCGTTTTTCTTGCATGCTTAGG - Intergenic
996252723 5:121356808-121356830 GACTTCTCTCTTGCTGGCTTAGG + Intergenic
996587034 5:125100834-125100856 GGCCTGTTTATTGCAGGCTGGGG - Intergenic
999317314 5:150592678-150592700 GGCCTCTGTCTTCCAGGCTATGG - Intergenic
999819640 5:155213561-155213583 GAAGTCCTTCTTGCAGTCTTGGG + Intergenic
1000588778 5:163132582-163132604 GAAGTATTTCTTTCAGGCTTAGG - Intergenic
1001079984 5:168660644-168660666 GGCATCTTTGCTGGAGGCTTAGG + Intergenic
1002390813 5:178910345-178910367 GGAGTCTTCCTTGCAGGGGTTGG - Intronic
1005843261 6:29758458-29758480 AGGGTCTTTCCTGCAGGGTTGGG - Intergenic
1006712518 6:36086814-36086836 GTTGTATTTCTGGCAGGCTTTGG - Intronic
1007721590 6:43888424-43888446 GGCTTCTTTCTGGCAGGAGTAGG - Intergenic
1009451242 6:63803473-63803495 GGAGCCTTTGTTACAGGCTTTGG - Intronic
1010844377 6:80686871-80686893 GTCGTTTCTCTTCCAGGCTTTGG - Intergenic
1014686101 6:124502234-124502256 GGAGTTTTTCTTTCAGACTTGGG + Intronic
1015324469 6:131908858-131908880 GGAGTCTTGCTTTCGGGCTTAGG - Intergenic
1023192528 7:37597912-37597934 GGTGACTCTCTTGCAGGCTAGGG + Intergenic
1024236120 7:47400556-47400578 GGTGTCTTTATTGCAGATTTGGG - Intronic
1027706807 7:81544748-81544770 TGGGTTTTTATTGCAGGCTTGGG + Intergenic
1032500788 7:132398325-132398347 AGGGTCTTCCTGGCAGGCTTTGG - Intronic
1033478548 7:141715301-141715323 GCTGTCTTTGTTGCTGGCTTCGG - Intronic
1033875403 7:145811094-145811116 GGAGTTTGTCTTGCATGCTTAGG + Intergenic
1041799261 8:61781036-61781058 GGCATCATACTTGCAGGTTTGGG - Intergenic
1044032940 8:87260957-87260979 GTCATTTTTCTTGCATGCTTAGG - Intronic
1044688955 8:94857594-94857616 AGAGTCTTTCTTGGAGCCTTTGG - Intronic
1049225678 8:141449459-141449481 GGCGGCTTTCCTCCAGGCTGGGG + Intergenic
1054176821 9:61881054-61881076 GCCGTGTTTCCTGCTGGCTTTGG + Intergenic
1054360851 9:64115977-64115999 GGAGTATTTCTTGCAGTCTTCGG - Intergenic
1056413248 9:86353318-86353340 AGTTTCTTTCTTACAGGCTTTGG - Intronic
1056795467 9:89655885-89655907 GTCGTCGTTTTTGCAGGGTTGGG - Intergenic
1057878279 9:98774125-98774147 GGAGTCTTTCCTGCAGAGTTGGG - Intronic
1057905240 9:98977746-98977768 GGGATCTTTTTTGCAGACTTTGG + Intronic
1059285002 9:113164942-113164964 GGCATCATCCTTGCAGGCTTTGG - Intronic
1203705809 Un_KI270742v1:44045-44067 GGAGTATTTCTTGTAGTCTTCGG - Intergenic
1186177513 X:6940667-6940689 GCCATCTTCCTTGCAGGATTAGG + Intergenic
1189307560 X:39998212-39998234 GGCTTCTCTCCTTCAGGCTTTGG - Intergenic
1191252224 X:58265158-58265180 GGGGGCTTTCTTGCCGACTTGGG - Intergenic