ID: 1125430422

View in Genome Browser
Species Human (GRCh38)
Location 15:39588195-39588217
Sequence GGGGCAGGCGTCTTTCTTGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 122}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125430422_1125430423 -10 Left 1125430422 15:39588195-39588217 CCTGCAAGAAAGACGCCTGCCCC 0: 1
1: 0
2: 0
3: 13
4: 122
Right 1125430423 15:39588208-39588230 CGCCTGCCCCAGTAAGTGTGAGG 0: 1
1: 0
2: 0
3: 10
4: 155
1125430422_1125430429 3 Left 1125430422 15:39588195-39588217 CCTGCAAGAAAGACGCCTGCCCC 0: 1
1: 0
2: 0
3: 13
4: 122
Right 1125430429 15:39588221-39588243 AAGTGTGAGGTCCGCTGCAAGGG 0: 1
1: 0
2: 0
3: 4
4: 96
1125430422_1125430430 12 Left 1125430422 15:39588195-39588217 CCTGCAAGAAAGACGCCTGCCCC 0: 1
1: 0
2: 0
3: 13
4: 122
Right 1125430430 15:39588230-39588252 GTCCGCTGCAAGGGTGAGCATGG 0: 1
1: 0
2: 0
3: 5
4: 94
1125430422_1125430431 13 Left 1125430422 15:39588195-39588217 CCTGCAAGAAAGACGCCTGCCCC 0: 1
1: 0
2: 0
3: 13
4: 122
Right 1125430431 15:39588231-39588253 TCCGCTGCAAGGGTGAGCATGGG 0: 1
1: 0
2: 0
3: 7
4: 59
1125430422_1125430428 2 Left 1125430422 15:39588195-39588217 CCTGCAAGAAAGACGCCTGCCCC 0: 1
1: 0
2: 0
3: 13
4: 122
Right 1125430428 15:39588220-39588242 TAAGTGTGAGGTCCGCTGCAAGG 0: 1
1: 0
2: 1
3: 7
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125430422 Original CRISPR GGGGCAGGCGTCTTTCTTGC AGG (reversed) Exonic
905815935 1:40950876-40950898 GGGCCAGGTATCTTTCTTTCAGG + Intergenic
906403950 1:45526557-45526579 TGGGGAGGAGGCTTTCTTGCAGG + Intergenic
912506720 1:110161685-110161707 GGGCCTGGGGTGTTTCTTGCTGG - Intronic
913502497 1:119483974-119483996 GGGGCTGATGTCTTTCTGGCTGG + Intergenic
915360830 1:155285455-155285477 GGGGCTAGGGTCTTTCTTGAAGG + Intronic
915540127 1:156560672-156560694 GGGGCAGGCAGTTTTCTTCCAGG - Intronic
915664701 1:157433968-157433990 GGGGCAGACATCTTTCCAGCAGG - Intergenic
920348978 1:205325144-205325166 GGGGTAGGCGTCTCCCTTCCAGG - Intergenic
922073702 1:222221387-222221409 GGGGCAGACATCTTTCCAGCCGG + Intergenic
924669986 1:246114379-246114401 GGGGCTGGCCTCTTCCTTGTTGG - Intronic
1064000237 10:11657853-11657875 GTGGCTGGCCTCTTTTTTGCTGG - Intergenic
1067187594 10:44043769-44043791 GGAGCCCGCGTCTGTCTTGCTGG + Intergenic
1069942766 10:71966200-71966222 GGGGCAGCCGTTTTTCTTCCTGG + Intronic
1073075630 10:100824595-100824617 GAGGCAGGCCCCTTTCTTCCAGG + Intronic
1073255268 10:102146905-102146927 AGGGCAGGCATCTTTTTTGGGGG - Exonic
1074720202 10:116257342-116257364 GGGGCAGGAGTCTCTGTGGCAGG - Intronic
1074933821 10:118157933-118157955 GTGGTAGTGGTCTTTCTTGCAGG + Intergenic
1075021891 10:118958189-118958211 GGAGCAGGCGTCTTACGTGGCGG - Intergenic
1075587960 10:123670973-123670995 AGGGCAGGGGTCCCTCTTGCTGG + Intronic
1076314518 10:129531200-129531222 GAGTCAGACGTCTTTCTTCCTGG + Intronic
1077543849 11:3160310-3160332 GGTCCAGGCGTCCTGCTTGCTGG - Intronic
1078337424 11:10475163-10475185 GGAGCAGGCGTCTTACATGGTGG + Intronic
1080263901 11:30380982-30381004 GGAGAAGGATTCTTTCTTGCTGG + Intergenic
1082781727 11:57293437-57293459 GAGACAGGTGTCCTTCTTGCGGG - Intergenic
1083233085 11:61335462-61335484 GGAGCAGGCCACTTTCTTGGAGG + Intronic
1083857481 11:65400342-65400364 GGGGCTGGGGTCCTTCTTCCGGG - Intronic
1092994776 12:13939517-13939539 GGTGCAGGCATCTGTCTTTCTGG - Intronic
1094051682 12:26227037-26227059 GCGGGAGGCATCTGTCTTGCGGG - Intronic
1096466214 12:51848760-51848782 GGGGTGGGGGTCTTTCCTGCGGG - Intergenic
1096541022 12:52307225-52307247 GAGGCAGGGGTCTGTCTGGCTGG + Intronic
1096773840 12:53952375-53952397 GGTGAAGGCGTCCTTCTTCCAGG - Intergenic
1101497118 12:105265267-105265289 GGGGCAGGCTTTTGTCTTACTGG - Intronic
1101782536 12:107848663-107848685 GGGGCTGACCTCTTTCTGGCTGG - Intergenic
1103929641 12:124443005-124443027 GGGGGAGGCTGCTTCCTTGCCGG - Intronic
1104162225 12:126191616-126191638 GGAGTGGGCGTCTTTCTCGCGGG + Intergenic
1104182782 12:126398791-126398813 AGGGCAGACATCTTTCTGGCAGG + Intergenic
1109895767 13:68687113-68687135 GGGGCATGCATCTTTCTTCAGGG + Intergenic
1114818416 14:25987037-25987059 GGGGTAGGAATCTATCTTGCAGG + Intergenic
1117207876 14:53463344-53463366 AGGGCAGGTGTGTTTCATGCAGG - Intergenic
1117690046 14:58297749-58297771 GAGGCAAACGTCTTTCTTGGAGG - Intronic
1118051141 14:62029378-62029400 GGGGCAGCCATGTTTCATGCTGG + Intronic
1125430422 15:39588195-39588217 GGGGCAGGCGTCTTTCTTGCAGG - Exonic
1128135262 15:65258417-65258439 GGGGCAGGCCTCTGTCTTGAAGG + Exonic
1133514607 16:6496381-6496403 GCGGCAGGCGTTTGTGTTGCTGG + Intronic
1134266357 16:12696268-12696290 GGTGCTGGCGTCCTTCTTGCGGG - Intronic
1135173639 16:20208982-20209004 TGGGCAGCCGTCTTTGTTGCAGG + Intergenic
1135331861 16:21567135-21567157 GGGGAAAGCGTGTTTCTTACAGG + Intergenic
1136075172 16:27812225-27812247 AGGGCAGGGGTCTTTCTGGGTGG - Intronic
1140041179 16:71409251-71409273 GGGGCTGACGTCTTTCCGGCAGG - Intergenic
1141674454 16:85510292-85510314 AGGGAAGGAGTCTTTCGTGCTGG - Intergenic
1143681898 17:8481955-8481977 GGGCAAGGCCTCTTTCTTGAAGG + Intronic
1144759835 17:17701034-17701056 GGGAGAGGGGTCTTTGTTGCAGG - Intronic
1144844496 17:18209392-18209414 GGGGCAGGCGCCTTCCTAGAAGG - Exonic
1154954621 18:21242226-21242248 GCGGCTGGCGTCTCTCTGGCAGG - Intronic
1155398681 18:25415250-25415272 GGGACAGGAGTTTTTTTTGCTGG - Intergenic
1158246612 18:55439339-55439361 GGGGCAGCCTCCTTTGTTGCTGG - Intronic
1160300242 18:77671642-77671664 ACAGCGGGCGTCTTTCTTGCAGG + Intergenic
1160456179 18:79003054-79003076 GGGGCAGGCATGTTTCTTCTGGG - Intergenic
1160624723 18:80195422-80195444 GGGGGAGGCTGCTTTCCTGCCGG - Intronic
1162668238 19:12233188-12233210 GGGGCAGACATCTTTCTGGCCGG - Intronic
1164827832 19:31297287-31297309 GGGGTAGGCGTCTGTGTGGCAGG + Intronic
1165277911 19:34770888-34770910 GGTGCAGGCCTCTCTCTAGCAGG - Intronic
1168317125 19:55489262-55489284 GGGGCAGGTGGCTGTCCTGCAGG - Intronic
928112168 2:28519502-28519524 GGAGCGGGTGTCTTTCTGGCAGG + Intronic
930627923 2:53719556-53719578 GGGGCTGACGTCTTTCTAGAAGG - Intronic
937927704 2:127179961-127179983 GGGGCATGCGTCTCTGTTGGTGG - Intergenic
938391682 2:130911772-130911794 GGGGCTGGCGTCTTGCTGGGGGG - Intronic
938841374 2:135168058-135168080 GGGGCATTGGTCTTGCTTGCTGG - Intronic
939185618 2:138857060-138857082 GAGGCAAGCTTCTTCCTTGCAGG - Intergenic
940639193 2:156329865-156329887 GGGGCAGGTGGCTGTGTTGCTGG + Exonic
943401407 2:187415836-187415858 GGTGCAGGGGTCTTACTTTCTGG - Intronic
948599345 2:239099613-239099635 AGGGCAGGCGGCTTTCTGTCCGG - Intronic
948918055 2:241048293-241048315 GTGACTGCCGTCTTTCTTGCAGG + Exonic
1171302786 20:24078365-24078387 GAGGCATGTGCCTTTCTTGCTGG - Intergenic
1173450581 20:43160050-43160072 CGGGCAGGCCTGTTTCCTGCAGG - Intronic
1176109586 20:63405347-63405369 GGGGCAGGCGGCTCTAATGCGGG - Intergenic
1176426695 21:6552834-6552856 TGGGCTGGCGTCTCCCTTGCTGG + Intergenic
1176458367 21:6932706-6932728 GGGGCATGGGGCTTTCTTGCTGG - Intergenic
1176836540 21:13797800-13797822 GGGGCATGGGGCTTTCTTGCTGG - Intergenic
1179702186 21:43161156-43161178 TGGGCTGGCGTCTCCCTTGCTGG + Exonic
1183661369 22:39223463-39223485 GGGGGAGGCCTCTGTCTGGCGGG - Exonic
1184587837 22:45459712-45459734 GGGGCAGGCCTCTTTCCCCCTGG + Intergenic
953500584 3:43429486-43429508 GGGGCAGGCAACTTCCTGGCTGG - Intronic
954373787 3:50183830-50183852 GGGGGAAGCGTCTTCCCTGCAGG + Intronic
955471757 3:59294080-59294102 GGGGCAGGTGTTTCTCATGCTGG - Intergenic
955687365 3:61561284-61561306 GGGGCCGGCTTGTTTTTTGCTGG - Intergenic
956061901 3:65356666-65356688 GGGGGAGCCGTCTCTCCTGCGGG + Exonic
956659096 3:71582121-71582143 GGGGCATGCGACTTTGTTTCCGG + Intronic
965662940 3:171061167-171061189 AGGGCTGGGGTCTGTCTTGCTGG + Intergenic
965891928 3:173524900-173524922 GGGGCAGGGGTTTTTATTACAGG - Intronic
967934893 3:194719301-194719323 TGGGCAGGTGGCTTTCTTTCTGG + Intergenic
970253847 4:14146305-14146327 AGGGCAGGCGTATTTCTTCAGGG + Intergenic
974674551 4:65073365-65073387 GGGGCAGGCATCTTCCTGGCTGG - Intergenic
976346127 4:84003549-84003571 TGGGCAGGGCTCTTTCCTGCTGG + Intergenic
984081476 4:175253853-175253875 GGGGCAGGGGACTTACTTGCAGG - Intergenic
986859121 5:11905011-11905033 TGGGCAAGGGTCTTTCTTGCAGG - Intergenic
987058695 5:14221005-14221027 AGGACAGGCGACTTTCTTGTTGG + Intronic
988920431 5:35936277-35936299 GGGGTAGGCCTCTGTGTTGCAGG - Intronic
992896650 5:81251633-81251655 GGGGAAAGCATATTTCTTGCTGG - Intronic
997114577 5:131112493-131112515 GGGGGAGGCGCCTATCTTGCAGG - Intergenic
999157227 5:149466750-149466772 GGGGATGGCGGCTCTCTTGCTGG + Intergenic
1000099736 5:158003815-158003837 GAGGAAGTCGTCTTTCTTGCTGG + Intergenic
1002277661 5:178114098-178114120 GGGGCAGGCGTCCTTGGCGCCGG + Intronic
1002838743 6:887731-887753 GTGGGAGGCGGCTTGCTTGCAGG + Intergenic
1007700471 6:43763340-43763362 GGGGAAGGGGCCCTTCTTGCTGG + Intergenic
1007861359 6:44912578-44912600 GGGGCAGGAGTCCTTCTGCCTGG + Intronic
1010865196 6:80967813-80967835 GGGGGAAGAGTCTTTCTTTCAGG + Intergenic
1020253765 7:6489854-6489876 GGGGCTGGAGTCTTCCTTCCAGG - Intergenic
1020787176 7:12587881-12587903 GGGGCTGGAGTGTATCTTGCAGG - Intronic
1026842161 7:73675760-73675782 GGGGCAGGAGAATTTCTTCCTGG - Intergenic
1029524308 7:101085762-101085784 TGGGACGGGGTCTTTCTTGCGGG - Intronic
1032959591 7:137015979-137016001 GGAGGAGGCTTCTTTTTTGCAGG - Exonic
1034850338 7:154487465-154487487 GGGGCAGGCGGTTTTCTGCCTGG + Intronic
1034922522 7:155095620-155095642 GGGGTTGGCGTGTTTCTGGCCGG - Intergenic
1039907627 8:41798172-41798194 GGCGCAGGAGTCCTTCTGGCCGG + Intronic
1042306471 8:67338459-67338481 TGAGCAGGTGTCTTTCTTGGAGG + Intronic
1049230444 8:141478865-141478887 GGGGCAGGTGTCTGTCCTGAGGG + Intergenic
1049577814 8:143397781-143397803 GGGGCGGGCATCCTTCTGGCTGG + Intergenic
1049578000 8:143398405-143398427 GGGGCAGGCGTCTTCCGAGAAGG + Intergenic
1053448492 9:38172312-38172334 GTGGCAGGTTTCTTTCCTGCAGG - Intergenic
1057138352 9:92710979-92711001 GGGGCAGGCATCTTTCCAGGGGG + Intergenic
1058924174 9:109645323-109645345 GGGGCAGGCCTTTCCCTTGCTGG - Intronic
1060183812 9:121551818-121551840 AGGGCAGGGGTCTGTCTTCCTGG + Intergenic
1060915120 9:127384380-127384402 GGGGCACACCTCTTTCTTCCTGG - Intronic
1062016859 9:134295490-134295512 GGGGCAGGCGCATTCCTGGCTGG - Intergenic
1062117456 9:134817117-134817139 GGGGCGGGGGTGTTTCATGCAGG - Intronic
1062155522 9:135046082-135046104 GGGGCAGGCACTTTTCTGGCTGG + Intergenic
1062439641 9:136564032-136564054 TGGGCAGGGGTCTTGCCTGCTGG - Intergenic
1187793235 X:22973520-22973542 GGGGCCTGCTTCTTTCTTGCAGG + Intergenic
1190343237 X:49313829-49313851 AGGGCAGTCGTCCTTCTTACCGG - Intronic
1192159059 X:68769304-68769326 GGGACAGGCTTCTTTCTGACTGG - Intergenic
1194135717 X:90138410-90138432 GGGGCTGGCGTCTTCCCAGCTGG + Intergenic
1198429217 X:136548890-136548912 GGGCTAGGCATCTGTCTTGCTGG - Exonic
1200080748 X:153575278-153575300 GGGGCAGGGGTCTGTCTGTCTGG - Intronic
1200481483 Y:3708491-3708513 GGGGCTGGCGTCTTCCCAGCTGG + Intergenic
1201479108 Y:14418276-14418298 GGGGCTGGCATGTCTCTTGCTGG + Intergenic