ID: 1125430428

View in Genome Browser
Species Human (GRCh38)
Location 15:39588220-39588242
Sequence TAAGTGTGAGGTCCGCTGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 61}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125430422_1125430428 2 Left 1125430422 15:39588195-39588217 CCTGCAAGAAAGACGCCTGCCCC 0: 1
1: 0
2: 0
3: 13
4: 122
Right 1125430428 15:39588220-39588242 TAAGTGTGAGGTCCGCTGCAAGG 0: 1
1: 0
2: 1
3: 7
4: 61
1125430421_1125430428 8 Left 1125430421 15:39588189-39588211 CCAAAGCCTGCAAGAAAGACGCC 0: 1
1: 0
2: 0
3: 9
4: 119
Right 1125430428 15:39588220-39588242 TAAGTGTGAGGTCCGCTGCAAGG 0: 1
1: 0
2: 1
3: 7
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125430428 Original CRISPR TAAGTGTGAGGTCCGCTGCA AGG Intronic
901808804 1:11754190-11754212 TAAATGGGAGTTCCTCTGCAAGG - Intronic
905601785 1:39258515-39258537 TGGGTGTGATGGCCGCTGCAAGG - Intronic
907444639 1:54499812-54499834 TAAGTGTGGGGTTCGCTCCTAGG - Intergenic
912479328 1:109967782-109967804 TAAGTATGATGTTAGCTGCAGGG - Intergenic
1066548588 10:36529596-36529618 TAAGTATGATGTTAGCTGCAGGG - Intergenic
1083254398 11:61487236-61487258 CAAGGGTGAGGTCCGCTTCCTGG + Exonic
1085229298 11:74950834-74950856 TGAGTGTGAGGCCAGGTGCATGG - Intronic
1085743402 11:79095354-79095376 TAAGTGTGGGGTACTGTGCAAGG - Intronic
1089194328 11:116684385-116684407 TAAGTATGATGTTAGCTGCAGGG - Intergenic
1089515330 11:119028425-119028447 TAAGTGTAATGTTCCCTGCAGGG - Exonic
1091234190 11:134008795-134008817 TAGGTGTCAGGACCTCTGCAAGG + Intergenic
1093259556 12:16918324-16918346 GAACTGTGAGCTCCGCTGCCTGG + Intergenic
1093426950 12:19038428-19038450 TAAGTTTGATGTCCTCTGCCTGG + Intergenic
1095901324 12:47331597-47331619 TAAGTATGATGTTAGCTGCAGGG + Intergenic
1096516320 12:52157513-52157535 TAAGTGCCAGGTCCACTGCAAGG + Intergenic
1097021956 12:56026971-56026993 CAAGTGTGACGTCTGCGGCATGG + Exonic
1100344910 12:93719074-93719096 TAAGTATGATGTTAGCTGCAGGG + Intronic
1102458852 12:113087726-113087748 TAAGTGTGAGGTATCCTGAAGGG + Intronic
1104061155 12:125269692-125269714 TATGTGTTAGGTTGGCTGCAGGG + Intronic
1104995680 12:132653776-132653798 TAAGTATGAGGTCTGCTGTTAGG + Intronic
1105447202 13:20467953-20467975 TAAGTGTGAGGTTCACAACAGGG - Intronic
1113754463 13:112801018-112801040 TAAGTATGACGTCAGCTGTAGGG - Intronic
1119554477 14:75542667-75542689 TAAGTGTCAGGCTGGCTGCACGG + Intronic
1125430428 15:39588220-39588242 TAAGTGTGAGGTCCGCTGCAAGG + Intronic
1128557235 15:68640085-68640107 TCACTGTGAGGTCAGATGCATGG - Intronic
1136477978 16:30525251-30525273 CAAATGTGAGGTCTGCAGCAAGG - Exonic
1139430382 16:66907988-66908010 CAAGACTGAGGTCCCCTGCAGGG - Intergenic
1154134345 18:11762516-11762538 TCAGTGTGACGCCAGCTGCATGG - Intronic
1155589992 18:27416464-27416486 TAAGTATGATGTTCACTGCAGGG - Intergenic
1162857739 19:13481991-13482013 TGAGTGTGGGGTCCTCTGCTTGG - Intronic
1165284209 19:34825781-34825803 TAAATGTGAAATCCGCTTCAAGG + Intergenic
1166420872 19:42635022-42635044 TAAGTGTGAGTTCAGATGGAGGG - Intronic
927218317 2:20682823-20682845 TAACTGTGAGGTCCTTAGCAAGG + Intergenic
927364588 2:22279236-22279258 TATGTGAGCGGTCCACTGCAAGG - Intergenic
928383886 2:30847350-30847372 TGAGTGCCAGGTCAGCTGCAGGG + Intergenic
933936259 2:87205997-87206019 TAAGTGTAAGCTCCGCTTCAAGG - Intergenic
935037129 2:99388399-99388421 TAAGTATGATGTCAGCTGCAGGG + Intronic
936356890 2:111759832-111759854 TAAGTGTAAGCTCCGCTTCAAGG + Intergenic
940200186 2:151141722-151141744 TAAGTTTGAGGTACTCTGAATGG - Intergenic
943053813 2:182949863-182949885 TATGTGTTAGGTCTGCAGCAAGG + Intronic
1173777855 20:45726091-45726113 TAAGTGTGCAGTTCGCTGCTAGG - Intergenic
959231603 3:103660993-103661015 AATGTGTGAGGTCAGATGCAGGG + Intergenic
966965578 3:184989221-184989243 TAAGTATGATGTTAGCTGCAAGG + Intronic
967633483 3:191774576-191774598 TAAGTGTGTGGCCAACTGCATGG - Intergenic
967845979 3:194043105-194043127 TAAGTGGGAGGTCAGCCTCACGG - Intergenic
977226669 4:94400003-94400025 TAAGTGTGTGGGCCCCTGGAAGG + Intergenic
988496670 5:31751347-31751369 TAATTGCAAGGTCCCCTGCAAGG - Intronic
990109220 5:52303505-52303527 TAAGTGTTAGGTCTTCAGCAAGG + Intergenic
997582954 5:135028655-135028677 CAGGTGTGAGGTCCGCGGCGCGG + Exonic
1003313522 6:4990046-4990068 TAAGTGTGATGTTAGCTGTAGGG + Intergenic
1011650832 6:89504680-89504702 TAAGTGTGAGCTACTCTGCCTGG + Intronic
1018863246 6:167727574-167727596 TAAGTGTGATGTTAGCTGTAGGG - Intergenic
1024437215 7:49372343-49372365 TTAGTGTGAGGTTAGCTGCGGGG + Intergenic
1027690064 7:81333757-81333779 CAGGCGTGAGGTCCGCTGCGAGG + Intergenic
1027906015 7:84183219-84183241 TAGGTGTGAGGACTGCAGCATGG - Intronic
1029900766 7:104036743-104036765 TAAGTTTGAGGATCCCTGCAGGG + Intergenic
1034874708 7:154714973-154714995 AAAGTGTGAGGGCCTCTGCTTGG - Intronic
1037173986 8:15925894-15925916 TAAGCGTGAGGTCCTCTGAACGG + Intergenic
1040652951 8:49470035-49470057 TAAGTATGAGGTCAGCTGCAGGG - Intergenic
1051111542 9:13643513-13643535 TTAGTTTGGGGTCTGCTGCATGG + Intergenic
1055577001 9:77670579-77670601 TAAGTGTAGGGACCACTGCAGGG + Intergenic
1061405644 9:130391788-130391810 GAAGGATGAGGCCCGCTGCATGG - Intronic
1062426189 9:136507287-136507309 TCAGGGTAAGGGCCGCTGCACGG - Exonic
1185467113 X:361729-361751 TACGTGTGTGGTCCCCCGCAGGG - Intronic
1186472653 X:9833501-9833523 TAATTAGGAGGTCCGATGCAGGG - Intronic
1189575300 X:42345058-42345080 TAAGTATGATGTCAGCTGTAAGG + Intergenic
1189741996 X:44128427-44128449 TAAGTGTGATGTTAGCTGTAGGG + Intergenic
1192162885 X:68801889-68801911 GAAGTGTGAGGTCCCCTGCCAGG + Intergenic
1194666466 X:96682514-96682536 TAAGTGTGAGGTACTGTGCAAGG - Intergenic
1195658205 X:107353308-107353330 GAAGTGTGATGTGCTCTGCACGG + Intergenic