ID: 1125431021

View in Genome Browser
Species Human (GRCh38)
Location 15:39593555-39593577
Sequence GAGTATCCCTGAGCCCTCGT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 68}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125431021_1125431028 19 Left 1125431021 15:39593555-39593577 CCCACGAGGGCTCAGGGATACTC 0: 1
1: 0
2: 1
3: 4
4: 68
Right 1125431028 15:39593597-39593619 GTAAACTCCACCACAGGGCCTGG 0: 1
1: 1
2: 0
3: 13
4: 149
1125431021_1125431026 13 Left 1125431021 15:39593555-39593577 CCCACGAGGGCTCAGGGATACTC 0: 1
1: 0
2: 1
3: 4
4: 68
Right 1125431026 15:39593591-39593613 AAAGTTGTAAACTCCACCACAGG 0: 1
1: 0
2: 0
3: 10
4: 86
1125431021_1125431027 14 Left 1125431021 15:39593555-39593577 CCCACGAGGGCTCAGGGATACTC 0: 1
1: 0
2: 1
3: 4
4: 68
Right 1125431027 15:39593592-39593614 AAGTTGTAAACTCCACCACAGGG 0: 1
1: 0
2: 1
3: 6
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125431021 Original CRISPR GAGTATCCCTGAGCCCTCGT GGG (reversed) Exonic
900074405 1:801415-801437 GAGTGACCCTGAGCCCTCCCAGG - Intergenic
906375340 1:45292189-45292211 GAGTAGCCCAGAGCCCTGGAAGG - Intronic
910232244 1:84998230-84998252 GAGTTGCCCTGCGCCCGCGTCGG + Intergenic
912867091 1:113267279-113267301 GAGTATCCCTGTGCCCAAGGGGG - Intergenic
915288180 1:154866033-154866055 GAATGTCCCTGAGCTCTCCTGGG + Intronic
922270252 1:224026319-224026341 GAGTGACCCTGAGCCCTCCCAGG - Intergenic
1063803893 10:9615292-9615314 CAGTATCCCTGAGCCCTAGGGGG + Intergenic
1067525074 10:47033655-47033677 GTGCATCCCTGATGCCTCGTGGG + Intergenic
1074301920 10:112240799-112240821 GAGCATCCCTGCGCTCTTGTGGG - Intergenic
1079777653 11:24553895-24553917 GAGTTTCCTTGAGCTCTCTTGGG + Intronic
1089410154 11:118234349-118234371 GAGTTTCCCTGAGACCTCAGGGG - Intronic
1106285162 13:28312329-28312351 GGGTATCCATGAGCTCTGGTGGG - Intronic
1108681391 13:52783578-52783600 CAGTCTCCCTGGGCCCTCTTGGG - Intergenic
1111034961 13:82659983-82660005 GAGTTTCCTTGACCCCTTGTGGG - Intergenic
1113821992 13:113221265-113221287 GAGTATCCCAGAGTCCTCACAGG + Intronic
1122513671 14:102290726-102290748 GAGGATCCCTGAACCCTAATGGG + Intronic
1124219688 15:27838834-27838856 CAGTACCCCTGAGCTTTCGTAGG - Intronic
1124423272 15:29540471-29540493 GAGTTTCACTGAGCCCTGGTGGG - Intronic
1124621226 15:31275198-31275220 GAGGATCCCAGAGGCCTGGTTGG + Intergenic
1125431021 15:39593555-39593577 GAGTATCCCTGAGCCCTCGTGGG - Exonic
1127894734 15:63287028-63287050 GTGTATTCCTGAGCCCAAGTGGG - Intronic
1128797590 15:70477026-70477048 AAGGATCCCTGAGCTCTCGCTGG - Intergenic
1135566254 16:23513385-23513407 GAGTTTCCCTGACCCATCTTGGG - Intronic
1136046620 16:27620294-27620316 GAATCCCCCTGAGCCATCGTCGG + Intronic
1138672698 16:58628843-58628865 TAGTATCTGTGAGCCCTCTTGGG + Intronic
1141515857 16:84544573-84544595 GAGGATGCCTGGGCCCTCGTGGG - Intronic
1145933506 17:28702004-28702026 GAGTCTCCCCTAGCTCTCGTGGG + Exonic
1146919244 17:36698875-36698897 GAGAATCCCTGCGGCCTCTTGGG - Intergenic
1147431141 17:40371522-40371544 GAGTCTCCCTGCTCCCTCCTGGG - Intergenic
1147927104 17:43952935-43952957 GAGGACCCCTGAGGCCTCCTGGG - Exonic
1149332967 17:55605625-55605647 GAGAATCCCTGAGGCCTGTTGGG - Intergenic
1152086095 17:78219682-78219704 GACCATCTCTTAGCCCTCGTGGG + Intronic
1152557686 17:81062544-81062566 GAGCCTCCCTGCTCCCTCGTGGG + Intronic
1157149013 18:45195947-45195969 GAGTATCCCTGAGCCTACTCTGG - Intergenic
1165114030 19:33518279-33518301 GAGTATCCCTGTGCCTTCCCTGG - Intronic
1168319414 19:55500303-55500325 GAGTATCCCTCAGGCCTCCCTGG + Exonic
926310356 2:11670250-11670272 GGGTGTCCCTGAGCCAACGTGGG + Intergenic
926631119 2:15137047-15137069 GAGTGTCCCTCAGGCCTCTTTGG - Intergenic
928175810 2:29033668-29033690 GGGTATCGCTGAGACCTAGTTGG + Intronic
932284971 2:70524493-70524515 GAGTATCGCCGAGCCCTCTCGGG + Intronic
932713150 2:74082464-74082486 GGGTGTCACTGAGCCCTGGTGGG + Intronic
934774379 2:96927799-96927821 GAGTGTCCCTGTGTCCTCCTGGG - Intronic
936974993 2:118209658-118209680 GAGTATCCCTGAGGGCAAGTTGG + Intergenic
940612422 2:156007273-156007295 TAGAAACCCAGAGCCCTCGTGGG + Intergenic
947893246 2:233644691-233644713 GAGAATCCCTGAGCCCTGGTGGG - Intronic
1173482709 20:43416050-43416072 GAGAATCCCAGAGTCCTCGAGGG + Intergenic
1173521754 20:43705151-43705173 GAGTATCCCTGAGACCTCAGGGG - Intronic
1174802962 20:53580577-53580599 TAATATTCCTGAGCCCTGGTGGG - Intronic
1177262560 21:18749847-18749869 GAGTGGCCCTCAGCCCTCCTTGG - Intergenic
1180081753 21:45490448-45490470 GGGTCTCCATGTGCCCTCGTGGG + Intronic
1183512482 22:38244177-38244199 GTGTATCCCTGAGAACTCATAGG - Intronic
954001995 3:47565181-47565203 GATTAAACCTGAGCCCTCGAGGG + Intronic
957624361 3:82640509-82640531 CAGTCTCCCTGAGCTCTCGAGGG + Intergenic
967067716 3:185935370-185935392 GTGTGTCCCTCATCCCTCGTTGG - Intronic
968624138 4:1618884-1618906 GATAAGCCCTGAGCCCTCGGGGG - Intronic
987886781 5:23823564-23823586 GAGTCTCCCTGAGCTCTTTTCGG - Intergenic
992314606 5:75539583-75539605 GAGTATCTCTGAAGCCTAGTAGG - Intronic
998206783 5:140162959-140162981 GAGTAACCCTGGGCCCTTGGCGG + Intergenic
998396943 5:141824825-141824847 GAGTATCCCTGGACACTCTTAGG - Intergenic
999257397 5:150217187-150217209 GCTTATCACTGAGCCCTCCTTGG + Intronic
1002072507 5:176688505-176688527 GAGTCTCCCTGTGCTCTTGTGGG - Intergenic
1024854848 7:53766109-53766131 GAGTCTCCCCGAGCCCTTATTGG - Intergenic
1027265700 7:76494163-76494185 GGGTGCCCCTGACCCCTCGTGGG + Intronic
1027317070 7:76992280-76992302 GGGTGCCCCTGACCCCTCGTGGG + Intergenic
1028351589 7:89856814-89856836 GAGAATCCCCCAGCACTCGTGGG + Intergenic
1031836461 7:126685916-126685938 GCTTTTCCCTGGGCCCTCGTGGG + Intronic
1035541237 8:440064-440086 GAGTGACCCTGAGCCCTCCCAGG + Intronic
1044159323 8:88893542-88893564 GAGTTTCCCTGCTCCCACGTTGG - Intergenic
1045754614 8:105528125-105528147 GAGAAGCCCTGAGCCCAGGTGGG + Intronic
1056336991 9:85581564-85581586 GAGTATCCCTGATTCTTAGTAGG - Intronic
1061149025 9:128818599-128818621 CAGCAGCCCTGTGCCCTCGTTGG + Exonic
1061943932 9:133897997-133898019 GAGTGTCCCTAAGCCCTGCTGGG - Intronic
1188507952 X:30903778-30903800 GAATTTCCCTCAGCCCTTGTAGG + Intronic
1196934929 X:120720060-120720082 GAGTATCCCTGACACCTTGGTGG + Intergenic