ID: 1125431026

View in Genome Browser
Species Human (GRCh38)
Location 15:39593591-39593613
Sequence AAAGTTGTAAACTCCACCAC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 86}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125431020_1125431026 14 Left 1125431020 15:39593554-39593576 CCCCACGAGGGCTCAGGGATACT 0: 1
1: 0
2: 0
3: 2
4: 73
Right 1125431026 15:39593591-39593613 AAAGTTGTAAACTCCACCACAGG 0: 1
1: 0
2: 0
3: 10
4: 86
1125431021_1125431026 13 Left 1125431021 15:39593555-39593577 CCCACGAGGGCTCAGGGATACTC 0: 1
1: 0
2: 1
3: 4
4: 68
Right 1125431026 15:39593591-39593613 AAAGTTGTAAACTCCACCACAGG 0: 1
1: 0
2: 0
3: 10
4: 86
1125431022_1125431026 12 Left 1125431022 15:39593556-39593578 CCACGAGGGCTCAGGGATACTCG 0: 1
1: 0
2: 1
3: 8
4: 83
Right 1125431026 15:39593591-39593613 AAAGTTGTAAACTCCACCACAGG 0: 1
1: 0
2: 0
3: 10
4: 86
1125431019_1125431026 18 Left 1125431019 15:39593550-39593572 CCAACCCCACGAGGGCTCAGGGA 0: 1
1: 0
2: 2
3: 28
4: 248
Right 1125431026 15:39593591-39593613 AAAGTTGTAAACTCCACCACAGG 0: 1
1: 0
2: 0
3: 10
4: 86
1125431014_1125431026 30 Left 1125431014 15:39593538-39593560 CCTACTGGGACACCAACCCCACG 0: 1
1: 0
2: 2
3: 9
4: 103
Right 1125431026 15:39593591-39593613 AAAGTTGTAAACTCCACCACAGG 0: 1
1: 0
2: 0
3: 10
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125431026 Original CRISPR AAAGTTGTAAACTCCACCAC AGG Exonic
904253053 1:29238008-29238030 AAAGTTGCAGGCTCCACCAAGGG - Intronic
904506953 1:30964892-30964914 TTAGTTGCAAACTCCAACACTGG - Exonic
906187885 1:43875419-43875441 AAAGTGGTAAACTCCAAGGCAGG - Intronic
907257036 1:53187340-53187362 AAATGTCTAAGCTCCACCACTGG - Intergenic
909896097 1:81070974-81070996 AAATTAGTTAACTCCACCACTGG - Intergenic
911399061 1:97351975-97351997 AAAATAGTAATCTCCACCTCTGG - Intronic
915619922 1:157074831-157074853 CAGGTAGTAAACTCCCCCACAGG - Intergenic
919521170 1:198590099-198590121 AAAGTTGAGAACTGCCCCACAGG - Intergenic
924185499 1:241485064-241485086 AACATTGTCCACTCCACCACAGG + Intergenic
1063951094 10:11224113-11224135 AAAGTTGAAAATGCCAGCACAGG + Intronic
1064058814 10:12120087-12120109 AAAGTTGAAAACTCCATCGTAGG + Intronic
1066179387 10:32944781-32944803 AATGTTGTAGACTCAGCCACTGG - Intronic
1067457010 10:46426152-46426174 AAAAGTGTCATCTCCACCACTGG - Intergenic
1067630194 10:47958487-47958509 AAAAGTGTCATCTCCACCACTGG + Intergenic
1068829101 10:61472694-61472716 AAGAATGTAAACTCCACCAGAGG + Intergenic
1073758575 10:106607106-106607128 AAAGTTGAAGACTCCACAAACGG + Intronic
1078085909 11:8232935-8232957 AGGGTTGTAAACTCCAGCACTGG + Intronic
1080348325 11:31352117-31352139 AAAGTTTTAAATTTCACCCCAGG - Intronic
1081890224 11:46535041-46535063 AAGTTTGTTAATTCCACCACAGG + Intronic
1095810304 12:46367631-46367653 CAAGTTTCAAACTCCATCACTGG - Intronic
1099343984 12:81474591-81474613 AAAATTTTAAACTCCACAAGAGG - Intronic
1100955877 12:99907454-99907476 ACTGTTGAAAACTCCACCATAGG - Intronic
1105328160 13:19389096-19389118 AGAGTGGTAAAATCCACCTCAGG + Intergenic
1106533749 13:30619171-30619193 TAAGTTGTAAAATCCCCCCCGGG + Intronic
1111647506 13:91049275-91049297 CAAGTTGTAATCTCCACCTGTGG - Intergenic
1113530824 13:111024909-111024931 AAAATTTAAAACTGCACCACAGG + Intergenic
1117092596 14:52266204-52266226 ATAGTTCTGAACTCCACCACTGG - Intergenic
1117787040 14:59296977-59296999 TAAGATGGAAACTCCAACACTGG + Intronic
1120462710 14:84817648-84817670 AAAGTTGGAAGCTCCAGCTCTGG - Intergenic
1125431026 15:39593591-39593613 AAAGTTGTAAACTCCACCACAGG + Exonic
1126525343 15:49648010-49648032 AAAGTTGTAAATGCAACCATAGG + Exonic
1128211001 15:65902479-65902501 CAAGCTGGAAACTCCACCTCAGG + Intronic
1133764787 16:8830279-8830301 AAATTTGTAACCCCCTCCACAGG + Intronic
1143737723 17:8924836-8924858 AAAGTTGTAAAAACCACACCTGG - Intronic
1144245222 17:13356180-13356202 AAAGTTTTCAACTCGACTACAGG - Intergenic
1147936849 17:44016738-44016760 AAAGTTGAAAACTCCAATGCTGG + Intronic
1150513135 17:65777239-65777261 AAAGTTGAGGACTGCACCACAGG + Intronic
1158312488 18:56173232-56173254 AAAGCTGTCAACTCCACCATAGG + Intergenic
1158940695 18:62404006-62404028 GAAGGTGTAAACTCCTTCACTGG - Intergenic
1161886965 19:7004586-7004608 AAAGCTGTGACCTCCACAACAGG - Intergenic
1162603761 19:11691434-11691456 AATGCTGTAAATTCCACCCCAGG + Intergenic
1165028230 19:32977622-32977644 AAAGTTGAAAACTCAACGGCCGG + Exonic
1165225273 19:34350354-34350376 AAAGTCTCAAACTCCACCCCCGG - Intronic
929350487 2:40946586-40946608 CATGTTTTAAACCCCACCACAGG + Intergenic
937087339 2:119180082-119180104 GAGGTTGGGAACTCCACCACTGG - Intergenic
940763368 2:157762875-157762897 AGAGTTGGAAACTCCAGCTCTGG + Intronic
942560746 2:177215706-177215728 AACGTTGAAAACACCTCCACCGG - Intronic
1170279897 20:14634379-14634401 AATTTTGTAAAGGCCACCACTGG + Intronic
1170472130 20:16678557-16678579 AACATTGTAAATTACACCACAGG + Intergenic
1170583250 20:17714776-17714798 ATATTTATACACTCCACCACAGG - Intronic
1174037121 20:47675132-47675154 AACGTTGTCAAGTCCCCCACTGG - Intronic
1176844586 21:13866803-13866825 AAATTTGTAATCTCCACAAGTGG - Intergenic
1176847319 21:13886366-13886388 AAATTTGTAATCTCCACAAGTGG - Intergenic
1178140135 21:29673318-29673340 AAAATGGTATAATCCACCACAGG - Intronic
1179406211 21:41127872-41127894 AAAGTGGCAAACTCCAACCCTGG - Intergenic
1180570773 22:16716881-16716903 GAAGTGGTAAACTCAATCACAGG + Intergenic
957107790 3:75912823-75912845 GAAGTGGTAAACTCAATCACAGG - Intronic
963481862 3:145885919-145885941 AAAAATGTAAACTCCACCCTTGG + Intergenic
967494193 3:190124342-190124364 AAATTTGAAAGCTCCACCCCAGG - Intergenic
969634533 4:8359229-8359251 AAAGAAGTAGACTGCACCACTGG + Intergenic
972175300 4:36397239-36397261 AATGTTATAAAGTCCCCCACTGG - Intergenic
972813133 4:42612664-42612686 AAAGTTGTCAACACCACTTCTGG - Intronic
973093925 4:46173642-46173664 AAAGTTGTGAACTCTACAACAGG - Intergenic
977937325 4:102822124-102822146 AAAGTTGAATGCTCCATCACTGG - Intronic
981920952 4:150084094-150084116 AAAGTTATAAACTTGACCTCAGG - Intronic
983814457 4:172106271-172106293 AAAATTGTAAAATCCACCTCAGG + Intronic
985238540 4:187903163-187903185 TGATTTGTAAACTCCAACACTGG - Intergenic
989081579 5:37628221-37628243 ATAGATTTAAACTGCACCACAGG - Intronic
991656324 5:68907553-68907575 AAAATTGTAAACTTTACCAAGGG - Intergenic
996711834 5:126551293-126551315 ATAGTTATAAACTCCAGCAGAGG - Intronic
1006874037 6:37279880-37279902 GAAGTTGTGGACTCCACCACAGG - Intronic
1012047079 6:94290393-94290415 AAAGTTGTAAGGTGCAACACAGG - Intergenic
1014953612 6:127589219-127589241 AAAGTGGTAGATTCCACCTCAGG + Intronic
1015747968 6:136530873-136530895 AATGTTGTAAAAGGCACCACAGG - Intronic
1018463073 6:164017510-164017532 AAAGTTGTAAAGTCCTCTGCTGG - Intergenic
1018896052 6:168018174-168018196 AAAGTTGAAAAATCTACCTCAGG - Intronic
1019055768 6:169222252-169222274 AAGGTGGTGAACTCCACCACGGG - Exonic
1023628061 7:42136497-42136519 ACAGTAGTAATCACCACCACAGG - Intronic
1030394143 7:108964415-108964437 AAAGTTGGTTTCTCCACCACTGG + Intergenic
1035813253 8:2511253-2511275 AAAGTTGTTATCAACACCACTGG - Intergenic
1044204054 8:89471114-89471136 AAGGTTATACACTCCACCCCAGG - Intergenic
1045306790 8:100964531-100964553 AAACTTGTAGACTCTTCCACAGG - Intergenic
1051416954 9:16851911-16851933 AGACTTGTAAATTCCACCAGAGG + Intronic
1052330048 9:27258633-27258655 CAAGTTGTAGCCTCCAACACAGG - Intergenic
1052374158 9:27698834-27698856 AAAGTGGCAAACTCCATCCCAGG + Intergenic
1054543575 9:66294681-66294703 ACACTTGAAAACTGCACCACTGG - Intergenic
1054739383 9:68789216-68789238 ACAGTTGTCAACACCATCACAGG - Intronic
1058939322 9:109798611-109798633 AAAGCTGTAAACTACATCACAGG + Intronic
1060159183 9:121344492-121344514 AAAGATGTAAACAACACCACCGG + Intronic
1060223627 9:121777130-121777152 AAGGAAGTAAACTCCACGACTGG - Intronic
1187553435 X:20328428-20328450 ACAAATGTAAACTCCACCAATGG + Intergenic
1187582400 X:20621983-20622005 AATGCTGGAAACTCCAGCACAGG - Intergenic
1191618380 X:63190886-63190908 AAAGTTGTAAACTCCTGGATGGG - Intergenic
1192490366 X:71571101-71571123 AAAATTTTAAAATGCACCACAGG - Intronic
1193056953 X:77162451-77162473 AAAGATGTGAACTCCCACACTGG + Intergenic
1193097749 X:77570593-77570615 AAACTTGTAAAATACAACACAGG + Intronic
1199294727 X:146144193-146144215 AAAGTTATAATGTGCACCACTGG - Intergenic