ID: 1125431028

View in Genome Browser
Species Human (GRCh38)
Location 15:39593597-39593619
Sequence GTAAACTCCACCACAGGGCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 1, 2: 0, 3: 13, 4: 149}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125431020_1125431028 20 Left 1125431020 15:39593554-39593576 CCCCACGAGGGCTCAGGGATACT 0: 1
1: 0
2: 0
3: 2
4: 73
Right 1125431028 15:39593597-39593619 GTAAACTCCACCACAGGGCCTGG 0: 1
1: 1
2: 0
3: 13
4: 149
1125431021_1125431028 19 Left 1125431021 15:39593555-39593577 CCCACGAGGGCTCAGGGATACTC 0: 1
1: 0
2: 1
3: 4
4: 68
Right 1125431028 15:39593597-39593619 GTAAACTCCACCACAGGGCCTGG 0: 1
1: 1
2: 0
3: 13
4: 149
1125431019_1125431028 24 Left 1125431019 15:39593550-39593572 CCAACCCCACGAGGGCTCAGGGA 0: 1
1: 0
2: 2
3: 28
4: 248
Right 1125431028 15:39593597-39593619 GTAAACTCCACCACAGGGCCTGG 0: 1
1: 1
2: 0
3: 13
4: 149
1125431022_1125431028 18 Left 1125431022 15:39593556-39593578 CCACGAGGGCTCAGGGATACTCG 0: 1
1: 0
2: 1
3: 8
4: 83
Right 1125431028 15:39593597-39593619 GTAAACTCCACCACAGGGCCTGG 0: 1
1: 1
2: 0
3: 13
4: 149
1125431025_1125431028 -7 Left 1125431025 15:39593581-39593603 CCTTTCTGTGAAAGTTGTAAACT 0: 1
1: 0
2: 1
3: 25
4: 218
Right 1125431028 15:39593597-39593619 GTAAACTCCACCACAGGGCCTGG 0: 1
1: 1
2: 0
3: 13
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125431028 Original CRISPR GTAAACTCCACCACAGGGCC TGG Exonic
904026835 1:27509333-27509355 CTTAACTCTAGCACAGGGCCTGG + Intergenic
904336296 1:29800467-29800489 GTGAACTCCTCCACAGCCCCGGG - Intergenic
906589104 1:47006983-47007005 GTAGACTCCACCACTGGGGCAGG + Intergenic
910949946 1:92635265-92635287 GTAGACTCCACCTCGGGGGCAGG - Intronic
914894789 1:151659649-151659671 GTAAATTTCAATACAGGGCCAGG - Intronic
915430694 1:155864267-155864289 GTAAGCTCTACCACAATGCCTGG + Intronic
915704709 1:157833009-157833031 ATAAAACCTACCACAGGGCCTGG + Intronic
920202669 1:204269292-204269314 ATATACTCCACCATGGGGCCAGG - Intronic
921005532 1:211089725-211089747 GAAAAATCAACCACAGAGCCAGG + Intronic
922495190 1:226051655-226051677 GTAACATTCAACACAGGGCCTGG + Intergenic
1066091387 10:32024779-32024801 CAAAACTCAACAACAGGGCCAGG + Intronic
1066556279 10:36617856-36617878 TTAAACTCCACCAGAACGCCTGG + Intergenic
1070022071 10:72596573-72596595 CAAAAATCCAACACAGGGCCAGG + Intronic
1070323470 10:75372417-75372439 GTCTACTCCACTAAAGGGCCAGG + Intergenic
1071701877 10:87947594-87947616 GAAAACTACACAAGAGGGCCGGG + Intronic
1074402616 10:113154223-113154245 GAAATCTCCACCTCAGGGTCAGG - Intronic
1077279710 11:1737588-1737610 TGAAACTCCACCACAGTGCCTGG + Intronic
1078844902 11:15112139-15112161 GCAAACTCCACCAGAGAGACTGG - Intergenic
1079682976 11:23321508-23321530 GTAGACTCCACCTCTGGGGCAGG + Intergenic
1079744944 11:24114076-24114098 GGAAACACCACCACAGAGGCAGG + Intergenic
1080110681 11:28563791-28563813 CTCAACTCCACCACACGGACTGG - Intergenic
1084912349 11:72400967-72400989 GCAAACACTAGCACAGGGCCTGG + Intronic
1085036346 11:73302506-73302528 GGAAACTCCATCCCTGGGCCTGG - Intergenic
1088775945 11:113083144-113083166 GCACACCCCACCACATGGCCAGG - Intronic
1090279387 11:125443029-125443051 GAAAACTCCACCACAGGGCCGGG - Intergenic
1091389694 12:118538-118560 GAAGACTCCTCCAGAGGGCCTGG - Intronic
1091695909 12:2627903-2627925 GTCAGCTTCCCCACAGGGCCGGG + Intronic
1091916498 12:4274340-4274362 GTAAACTCCCGCACAGGAGCCGG - Intronic
1092173489 12:6387895-6387917 GTAAACACCCCCACAGGTACAGG + Intronic
1092230824 12:6774370-6774392 GTAAACTCCAGGCCAGGGACGGG + Intronic
1093919107 12:24839418-24839440 GTGAACTCAACCACAAGGCCTGG + Intronic
1096967252 12:55638214-55638236 GTAAACTCCTCCACAGGCTTTGG - Intergenic
1097363085 12:58679849-58679871 ATAAACACCACCAATGGGCCTGG - Intronic
1098182426 12:67862197-67862219 CTCAGCACCACCACAGGGCCTGG - Intergenic
1099343982 12:81474585-81474607 TTAAACTCCACAAGAGGGCCAGG - Intronic
1101292852 12:103388981-103389003 CTAAACTCAACCCCAGGGGCTGG - Intronic
1103147145 12:118604720-118604742 GTAGCACCCACCACAGGGCCGGG + Intergenic
1104896863 12:132168964-132168986 GTGCACTCCGCCAGAGGGCCGGG - Intergenic
1106177206 13:27341719-27341741 GTGAACTACGCCCCAGGGCCTGG - Intergenic
1108892459 13:55278169-55278191 GTAGACTCCACCTCAGAGGCAGG - Intergenic
1111060476 13:83012194-83012216 CTAAAGACCACCATAGGGCCAGG - Intergenic
1112193412 13:97200308-97200330 GCACAATCCACCACAGTGCCTGG + Intergenic
1112531547 13:100208570-100208592 ATTAGCTCCACCACAGGGCATGG - Intronic
1114581257 14:23762295-23762317 GTAGACTCCACCTCTGGGGCAGG - Intergenic
1114823850 14:26053634-26053656 TTCATCTCTACCACAGGGCCAGG - Intergenic
1118242955 14:64079357-64079379 GTAAACTCCAGCATAGGGAAAGG + Intronic
1121592269 14:95125348-95125370 GAAAACACCACCACAAGGTCAGG + Intronic
1122143171 14:99674412-99674434 CTATACCCCACCACAGAGCCTGG - Intronic
1124809208 15:32917441-32917463 GTCCACTCCACCACAGGGTGAGG + Intronic
1125431028 15:39593597-39593619 GTAAACTCCACCACAGGGCCTGG + Exonic
1130798386 15:87235336-87235358 GTAGACTCCACCTCTGGGGCAGG - Intergenic
1133121168 16:3609106-3609128 TTAAAGTCCACAACTGGGCCGGG + Exonic
1134570199 16:15284242-15284264 ATAAACACCACAACAGGGCATGG - Intergenic
1134589739 16:15442950-15442972 ATAAAGAACACCACAGGGCCGGG + Intronic
1134636074 16:15793058-15793080 TTAAACTCCTCCCCAGGGCCTGG + Intronic
1134732176 16:16471811-16471833 ATAAACACCACAACAGGGCATGG + Intergenic
1134935261 16:18240152-18240174 ATAAACACCACAACAGGGCATGG - Intergenic
1136035829 16:27539444-27539466 GGAGACTCCACCACAATGCCTGG + Intronic
1143518949 17:7434812-7434834 CGAAACTCCACCCTAGGGCCTGG - Intergenic
1145346747 17:22046682-22046704 CTGATGTCCACCACAGGGCCTGG - Intergenic
1147527559 17:41240444-41240466 GTAGACTCCACCTCTGGGGCAGG + Intronic
1151001415 17:70381204-70381226 CAAAACTCCATCACAAGGCCAGG - Intergenic
1152211993 17:79007626-79007648 GTAAAAACACCCACAGGGCCAGG + Intronic
1152267929 17:79306951-79306973 GAAAACTCCCTCAGAGGGCCTGG - Intronic
1152736305 17:81998989-81999011 GAAAAGTCAGCCACAGGGCCAGG - Intronic
1157556129 18:48613890-48613912 GTAAAGGGCACCACAGGGGCGGG - Intronic
1158496707 18:57961603-57961625 GTTGACTTCACCACAGGCCCAGG - Intergenic
1162212525 19:9103822-9103844 GAAAACTCCACTCCTGGGCCAGG - Intergenic
1165560067 19:36671508-36671530 GAAAACTCCCCAACAGGACCAGG + Intergenic
1166019113 19:40008939-40008961 CTAAACTCTAGCACAGTGCCTGG - Intronic
1168152828 19:54458166-54458188 GTAAACTCGCCCACATTGCCAGG - Exonic
925311360 2:2886006-2886028 GTAGACTACACCACATAGCCTGG - Intergenic
925444496 2:3915979-3916001 GTAAAGTACAGCAAAGGGCCAGG - Intergenic
926917700 2:17909044-17909066 GTAGACTCCACCTCTGGGGCGGG - Intronic
928172191 2:29010972-29010994 GTAATCCCCATCCCAGGGCCTGG - Intronic
933755760 2:85637129-85637151 TTATCCTCCATCACAGGGCCTGG - Intronic
935215791 2:100974411-100974433 GTAAACTCATCCACTGGGACAGG - Intronic
938187021 2:129240684-129240706 GAAAACTACACCAAAGGGGCAGG + Intergenic
938864451 2:135403508-135403530 GTAGACTCCACCTCCGGGGCAGG + Intronic
942865783 2:180673233-180673255 AGAAACTTTACCACAGGGCCAGG - Intergenic
945529672 2:210935675-210935697 GTAATCTCCACCACAGAGGTAGG - Intergenic
947646597 2:231746436-231746458 GTAAAATACACCAACGGGCCAGG - Intronic
948167675 2:235875600-235875622 CTCTACTCCACCACAGGCCCGGG - Intronic
1170634575 20:18093268-18093290 TCAAACACTACCACAGGGCCTGG - Intergenic
1180787265 22:18553949-18553971 GTAAAGTGCCCGACAGGGCCAGG - Intergenic
1181244173 22:21493474-21493496 GTAAAGTGCCCGACAGGGCCAGG - Intergenic
1181441704 22:22939359-22939381 GAGAACACCACCACAGGGGCAGG + Intergenic
1181750935 22:24988845-24988867 GAAAACTCCAGCACAGTACCTGG - Intronic
1183310045 22:37104663-37104685 TTAAAATGCACCCCAGGGCCGGG + Intronic
1184694907 22:46133748-46133770 TTACACTGCACCACAGGGCTGGG - Intergenic
949300484 3:2577879-2577901 GTAAACTGCACCACAGAGATGGG - Intronic
950906811 3:16545997-16546019 CCCAACTCCACCACAGGCCCTGG - Intergenic
953457043 3:43051763-43051785 GTAAACTCCACTAAAAGGCATGG - Intronic
954831096 3:53421983-53422005 GGAGACTACACCCCAGGGCCTGG - Intergenic
955879764 3:63530916-63530938 GAAAACTCCCCCACAAAGCCTGG - Intronic
956004972 3:64769186-64769208 GTCAACTCCAGCCCATGGCCTGG + Intergenic
956013675 3:64858599-64858621 GCAAACTCTGCCACAAGGCCAGG + Intergenic
960483896 3:118227487-118227509 GCAAACTCAACCACTGGGCCAGG + Intergenic
961171292 3:124799623-124799645 GAAAAGTCCAGCACAGTGCCTGG - Intronic
961781705 3:129324413-129324435 AAAACCTCCAACACAGGGCCAGG + Intergenic
962813764 3:138980374-138980396 GAAAACTCCACCACTGAGCGTGG - Intergenic
964674909 3:159267173-159267195 GTAAACTACAGCACAGAACCTGG + Intronic
968225081 3:196968396-196968418 GTAAACTCCACTCCAGGGCACGG - Intronic
974470233 4:62309800-62309822 GTAGACTCCACCTCTGGGGCAGG + Intergenic
975260962 4:72298272-72298294 GTTACCTCCACCACAGGGTTTGG + Exonic
977365627 4:96064419-96064441 GCAATGTCCACCCCAGGGCCTGG - Intergenic
979757651 4:124361764-124361786 GTAGACTCCACCTCTGGGGCAGG + Intergenic
980935416 4:139221215-139221237 GTAAGCTGAACCACAGGGGCTGG + Intergenic
981566215 4:146104548-146104570 GAAAAATTCAACACAGGGCCTGG + Intergenic
984730558 4:183064561-183064583 GGAAGCTCCACCTCAGGTCCTGG - Intergenic
985530505 5:431184-431206 CTACGCTCCACCCCAGGGCCGGG - Intronic
985950245 5:3217443-3217465 GAACACTCCACAACAGGGCCTGG + Intergenic
987318403 5:16745541-16745563 GCATACACCACCACTGGGCCTGG - Intronic
998162431 5:139821226-139821248 TTAAAATCCATCACTGGGCCAGG - Intronic
1001009205 5:168083038-168083060 GTAGACTCCACCTCGGGGGCAGG - Intronic
1001100976 5:168814098-168814120 TTAAAAACCACCACAGGGCCGGG + Intronic
1001812188 5:174637263-174637285 TTAAATTCCACCAGAAGGCCGGG + Intergenic
1001907212 5:175482871-175482893 GGAAATTACACCACAGGGCGGGG + Intronic
1005446218 6:25925819-25925841 GGAAACTCCACCACAAAGCGTGG - Exonic
1006073529 6:31514780-31514802 GAAAACTGCGGCACAGGGCCAGG + Intergenic
1006874035 6:37279874-37279896 GTGGACTCCACCACAGGGAAAGG - Intronic
1007374351 6:41446046-41446068 GGAAACTCCAGTACAGGGCAGGG - Intergenic
1010688356 6:78878048-78878070 GTAGACTCCACCTCTGGGGCAGG + Intronic
1011303066 6:85896556-85896578 GTAGACTCCACCTCTGGGGCAGG - Intergenic
1011701550 6:89959998-89960020 GGACACTCCACCACAGAGTCAGG - Intronic
1019055765 6:169222246-169222268 GTGAACTCCACCACGGGGACGGG - Exonic
1019674101 7:2300937-2300959 TTAAGCTCCACAACAGGGGCTGG - Intronic
1019728085 7:2613917-2613939 CTAAACTCCAACCCAGGGCCCGG + Exonic
1020344141 7:7145212-7145234 GTAGACTCCACCTCTGGGGCAGG - Intergenic
1028659626 7:93254560-93254582 GAATACTCCATTACAGGGCCAGG - Intronic
1029323108 7:99782614-99782636 GTGACCTCCACTACGGGGCCAGG + Intronic
1030282146 7:107787929-107787951 GTAAACCCCCCAAGAGGGCCAGG - Intronic
1030541033 7:110831018-110831040 GTGAACTCTCCCCCAGGGCCAGG - Intronic
1030737545 7:113067483-113067505 CTAAAATCCAGCACAGTGCCTGG - Intergenic
1031545508 7:123047423-123047445 TTAATCTGCACCATAGGGCCAGG - Intergenic
1032666911 7:134046184-134046206 GTTAAAACCACCTCAGGGCCGGG + Intronic
1033648996 7:143326436-143326458 GCAAGATCCAACACAGGGCCTGG - Intronic
1034272285 7:149809078-149809100 GTAGCCACCACCACAGGGCACGG - Intergenic
1036557791 8:9875250-9875272 GTAACCTCCACATCAGGCCCTGG + Intergenic
1037065979 8:14578000-14578022 GTACACTACATCAAAGGGCCAGG + Intronic
1038282141 8:26175066-26175088 GGAAATTCCACCCCAGGGACTGG + Intergenic
1040380366 8:46865880-46865902 AGAAACTCCACCACAGGCCCAGG - Intergenic
1042763077 8:72291586-72291608 GTAGACTCCACCTTTGGGCCAGG + Intergenic
1043605111 8:81990695-81990717 GTAGACTCCACCTCTGGGGCAGG - Intergenic
1046704464 8:117434858-117434880 GTAGACTCCACCTCTGGGGCAGG + Intergenic
1047372707 8:124269142-124269164 GTTAAGTCCACCACAGAGCCAGG + Intergenic
1048337095 8:133510862-133510884 GCAAACTCCATCACAGGGGAAGG + Intronic
1050318045 9:4423294-4423316 CTAAACTCCACCACACGGAAGGG + Intergenic
1051454750 9:17242451-17242473 GTATGCACCACCACTGGGCCTGG + Intronic
1056088466 9:83180645-83180667 TAAACCTCCACCACAGTGCCTGG - Intergenic
1056121348 9:83492249-83492271 TTAAACTACACCACGAGGCCTGG + Intronic
1056657872 9:88523866-88523888 GTACCCTCCACCCCAGGGGCTGG + Intergenic
1062060561 9:134493162-134493184 GTTAACTCCACAACTGGCCCCGG - Intergenic
1187582399 X:20621977-20621999 GGAAACTCCAGCACAGGACTAGG - Intergenic
1187913714 X:24133539-24133561 GTAATCTCCTCCAGTGGGCCAGG - Intergenic
1191170675 X:57444195-57444217 GTAGACTCCACCTCTGGGGCAGG - Intronic
1192270203 X:69571941-69571963 TGAATCTCCAGCACAGGGCCTGG + Intergenic
1193035906 X:76950919-76950941 GCAGACTCCACCTCAGGGGCAGG + Intergenic
1193749581 X:85326230-85326252 GTGAACACCACCACAGAGGCCGG - Intronic
1196139570 X:112246312-112246334 GTAGACTCCACCTCTGGGGCAGG - Intergenic
1197450885 X:126615954-126615976 CCCAACTCCACAACAGGGCCCGG - Intergenic
1200100055 X:153685819-153685841 GTGAACTCCTCCTCACGGCCTGG - Intronic
1200751954 Y:6954259-6954281 GTAGACTCCACCTCTGGGGCAGG - Intronic
1202085175 Y:21129108-21129130 GTAGACTCCACCTCTGGGGCAGG - Intergenic