ID: 1125435525

View in Genome Browser
Species Human (GRCh38)
Location 15:39640748-39640770
Sequence AATGACATACAGAAATTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 371
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 338}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125435522_1125435525 24 Left 1125435522 15:39640701-39640723 CCACGTGGTAGAAGAAGATTTAC 0: 1
1: 11
2: 104
3: 177
4: 254
Right 1125435525 15:39640748-39640770 AATGACATACAGAAATTGGAAGG 0: 1
1: 0
2: 2
3: 30
4: 338

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125435525 Original CRISPR AATGACATACAGAAATTGGA AGG Intronic
902029281 1:13409887-13409909 AATAAAATACAAAAATTGGCTGG - Intergenic
902063457 1:13664737-13664759 CATGCCCTACAGAAATTGGAGGG - Intergenic
905255824 1:36683439-36683461 AATGAGATATAGAAGTTTGATGG + Intergenic
905975420 1:42170755-42170777 AATGTCACACAGAAAGTGGATGG + Intergenic
906044194 1:42815469-42815491 AATAACCTACAGAAATTCTAAGG + Intronic
909589264 1:77327702-77327724 AATAACTTTCTGAAATTGGAGGG - Intronic
909929633 1:81481357-81481379 AAAGACAGAAAGAAATTAGAAGG + Intronic
910699327 1:90056176-90056198 AATAAGATATAGAAATTGGAAGG + Intergenic
911147384 1:94565911-94565933 CCTGACATACAGTAATTGGAAGG - Intergenic
912146297 1:106798294-106798316 AATGACATTCATAAAATTGATGG + Intergenic
912190716 1:107336981-107337003 AAGGACATGAAAAAATTGGAGGG + Intronic
912265489 1:108152926-108152948 TATGACATATAGAAAGAGGAAGG + Intronic
912558445 1:110533151-110533173 AGAGACAAACAGAAATTGGTGGG + Intergenic
913032273 1:114920927-114920949 AAAGACATAGAGCAATTGAATGG - Intronic
913133864 1:115868210-115868232 GATTACTTACAGAAAGTGGATGG - Intergenic
913377884 1:118174687-118174709 AAAGACAGACAGAATTTTGAAGG + Intronic
914711985 1:150222594-150222616 AAAAACATACAGAAATTAGCTGG + Intronic
916078591 1:161218025-161218047 AATTCCATACAGAAACAGGATGG - Exonic
917338954 1:173954700-173954722 AATGACATAAAAAATTTGGACGG + Intronic
917934666 1:179853816-179853838 GATGCCATAGATAAATTGGAAGG + Intronic
920058118 1:203207388-203207410 AGTGAAGTACAGGAATTGGAAGG + Intergenic
920289576 1:204909718-204909740 AAAGACAAACTCAAATTGGATGG - Intronic
920966124 1:210702317-210702339 AAAGAAAAACAGAAAATGGAGGG - Intronic
921006737 1:211101055-211101077 AGTGCCATGCAGAAACTGGAAGG - Intronic
921098513 1:211908318-211908340 AATAAAATACAAAAATTGGCTGG + Intergenic
922290984 1:224208626-224208648 AATGACACACAGTGAGTGGAAGG + Intergenic
923383193 1:233442017-233442039 AATACCATACAGAAGCTGGAAGG + Intergenic
924430463 1:243992091-243992113 AATGAAATCCAGAAACTGGCTGG + Intergenic
1063735903 10:8754067-8754089 AAATGCATGCAGAAATTGGAGGG + Intergenic
1063924798 10:10967149-10967171 AATGACCTACAGAACGTGGGAGG + Intergenic
1064558314 10:16569943-16569965 AATGAGTGACAGTAATTGGAAGG - Intergenic
1065064789 10:21950226-21950248 AATGTGATACAGAAACAGGAAGG - Intronic
1065710921 10:28517030-28517052 AATGAAAAAAAGAAATTGCAAGG - Intergenic
1067920361 10:50449559-50449581 AAGGACATGAAGAAAGTGGAGGG - Intronic
1067962448 10:50870295-50870317 ATGGACAAAAAGAAATTGGAAGG + Intronic
1068099942 10:52539992-52540014 AATGAAAAAGAGAAATTGTAGGG - Intergenic
1068272073 10:54741413-54741435 AAGGACATATAGAAAGTGAAAGG + Intronic
1068796852 10:61092788-61092810 AATAACATTCAGAAATTAGTTGG - Intergenic
1068830344 10:61487009-61487031 AATGACACACAGATAATGAATGG + Intergenic
1069292488 10:66797900-66797922 ATTGACATTATGAAATTGGAAGG - Intronic
1070703226 10:78618510-78618532 ACTGAAATACAAAAATTAGATGG + Intergenic
1071617704 10:87091807-87091829 AATGAGATACAGAAAGCTGAAGG + Intronic
1073902955 10:108244860-108244882 AAAAACAGACAGAAATTGCATGG - Intergenic
1074513718 10:114144150-114144172 AATAACACTGAGAAATTGGACGG - Intronic
1074940668 10:118233626-118233648 AATGACAAACAGAAGTTTAATGG + Intergenic
1077842217 11:5987335-5987357 AATGAGATAGAGAAAATGGTGGG - Intergenic
1077905415 11:6529149-6529171 ATAGACATACAGAAAAGGGAAGG - Intronic
1078600421 11:12725301-12725323 AATGTTATAAAGAAATTGTAAGG - Intronic
1078838534 11:15055638-15055660 AATGTCATAAAGAAATTAAAAGG + Intronic
1079786899 11:24684612-24684634 AATAACAGATAGAAATTGGAGGG + Intronic
1079966454 11:26986014-26986036 AATGACATTCAGAAATCAGCTGG - Intergenic
1080171986 11:29315486-29315508 AATGACATATAAAATTAGGAAGG - Intergenic
1080172620 11:29323947-29323969 AATCACATAAAGAAATGGAAGGG - Intergenic
1080498384 11:32844872-32844894 AAAGAAATACAAATATTGGATGG - Intronic
1081090155 11:38854778-38854800 GATGACATTAAGAAAGTGGAAGG - Intergenic
1082035728 11:47643900-47643922 ATTGAAATACAGATATTGGCTGG + Intergenic
1083373200 11:62198391-62198413 TAAGTCATACAGAACTTGGAAGG - Intergenic
1083910041 11:65701925-65701947 AATGGTATACAGAAATTCAATGG - Intergenic
1085087964 11:73685010-73685032 AATCACATAGTGAAATTGAAAGG + Intronic
1086859880 11:91913279-91913301 TATCACATATAGAAATTGAATGG + Intergenic
1087430533 11:98047762-98047784 ATAGAGATACAGAAATGGGAAGG - Intergenic
1087507285 11:99042045-99042067 AATGAGAGACACAAATTTGATGG - Intronic
1087707064 11:101505426-101505448 AATGACAAGCTGAAAATGGAAGG + Intronic
1087707889 11:101515729-101515751 AATGAAATATAGCAATTTGATGG + Intronic
1091256472 11:134191398-134191420 AATGATAAACAGAGATTGCATGG + Intronic
1091270247 11:134305864-134305886 AATTAAATATAGAAGTTGGAAGG + Intronic
1092251529 12:6901037-6901059 AATGCCATACAGAGAAAGGAGGG + Intronic
1093311258 12:17588926-17588948 AAAGACACACAGACATTTGATGG + Intergenic
1093421738 12:18981887-18981909 AATGACAAACAGAAGAGGGAGGG + Intergenic
1095041638 12:37448719-37448741 AATGACATAGAAAAATGGGGGGG + Intergenic
1095473998 12:42566403-42566425 GATGGCAAACAGAAATTGGAGGG + Intronic
1095504180 12:42875370-42875392 AATCATATTCATAAATTGGAAGG - Intergenic
1098372241 12:69772275-69772297 AAGGACATACAGAGACTGAAAGG - Intronic
1098396512 12:70024211-70024233 AATGAAATAAAGAAATATGAAGG + Intergenic
1098711364 12:73767018-73767040 AGTGACATACAAAAAATGGAAGG - Intergenic
1099034594 12:77570168-77570190 ACTGTCATACAGAAAATAGAAGG - Intergenic
1099142089 12:78990809-78990831 AACTTCATACAGAAGTTGGATGG - Intronic
1099851287 12:88100379-88100401 AAGGAAATACAAAAACTGGATGG - Intronic
1100124663 12:91408820-91408842 AATCACCTGCAGATATTGGAGGG + Intergenic
1100124810 12:91411069-91411091 AATCACCTGCAGATATTGGAGGG + Intergenic
1100151066 12:91738273-91738295 ATAGACACACTGAAATTGGATGG + Intergenic
1100668390 12:96781260-96781282 AAAGACATTCAGAAATTCTAGGG + Intronic
1102363171 12:112306378-112306400 AATAACATACACAAATTACATGG + Intronic
1102838999 12:116097701-116097723 AATGACATACACAAGTGGCATGG - Intronic
1105951866 13:25236188-25236210 AATGACTGAAAGAAATTGGGGGG + Intergenic
1108052616 13:46461135-46461157 AAGAAGATACTGAAATTGGACGG - Intergenic
1108932254 13:55839830-55839852 TTTGACATACAGAAAATGTAGGG - Intergenic
1110550796 13:76809316-76809338 AATGAAAAACAGGAATTGGGAGG + Intergenic
1111193253 13:84836889-84836911 AATTTCATACAGAAATTCAAGGG + Intergenic
1111306248 13:86416590-86416612 AGTTACATACAAAAATTGGATGG - Intergenic
1111516761 13:89343164-89343186 AATGACAGAAAGAAATTAAAGGG + Intergenic
1111527332 13:89490263-89490285 CATGACATACATAAATTGCCTGG - Intergenic
1111743776 13:92239193-92239215 AAAGTCATACAGAAATTCAAGGG - Intronic
1113224261 13:108142100-108142122 AATGACATACAGACATGTTAAGG + Intergenic
1113385535 13:109844456-109844478 AATGAAATGCAGCAATTAGATGG - Intergenic
1114153714 14:20074793-20074815 TAGGAGATACAGACATTGGAAGG + Intergenic
1114270864 14:21098899-21098921 AAAGAGAGACAGAAATTGTAAGG - Intronic
1115518955 14:34213697-34213719 AATTTCCTTCAGAAATTGGAAGG + Intronic
1115520923 14:34232147-34232169 AACGACATACAAAAACAGGACGG + Intronic
1115908790 14:38232224-38232246 AATTAGATACAGAAAATTGAGGG + Intergenic
1116704016 14:48273908-48273930 AATCACGTACAGAAATTAGCAGG - Intergenic
1118540636 14:66820181-66820203 TATAATAAACAGAAATTGGAAGG - Intronic
1118566872 14:67151098-67151120 AATACCTTACAGAAATAGGAAGG + Intronic
1118925218 14:70185780-70185802 AATCACATACATAAATTTAATGG + Intronic
1120560176 14:85982205-85982227 AAAGAATTACAGAAATTTGAGGG - Intergenic
1120762505 14:88298279-88298301 AAAGCCAAACAGAAATTGTATGG + Intronic
1122078759 14:99252722-99252744 ACTGACATTCAGGACTTGGAGGG + Intronic
1124156619 15:27231521-27231543 AATGACATTCAGAAATTGACAGG - Intronic
1125123279 15:36189504-36189526 ACTGACATACAGAAATATGCAGG + Intergenic
1125310103 15:38370080-38370102 AATGAAACACAGAGATGGGAGGG + Intergenic
1125345095 15:38711230-38711252 AAGGAAACACAGAATTTGGATGG + Intergenic
1125435525 15:39640748-39640770 AATGACATACAGAAATTGGAAGG + Intronic
1125820027 15:42621546-42621568 AGTGACATACAGAAAACAGAGGG + Intronic
1126531920 15:49719917-49719939 AATGACATCCGAAAATTGGAAGG - Intergenic
1128330571 15:66753028-66753050 CATGACATACAGCTCTTGGAAGG + Intronic
1129358031 15:75005547-75005569 CATGAAAGACAGAAATTGGCAGG - Intronic
1131384026 15:91987789-91987811 AATGACATTCTGACATTTGATGG + Intronic
1131636002 15:94233896-94233918 AATTACACACAGAAATGGAAGGG + Intronic
1132950150 16:2557176-2557198 AATGAGACACAGAAATACGAAGG - Intronic
1132964196 16:2642994-2643016 AATGAGACACAGAAATACGAAGG + Intergenic
1135695063 16:24578613-24578635 TATGACATAAAGAAAATGCAGGG - Intergenic
1135902811 16:26480400-26480422 AAAGACATACATAGATTGAAAGG + Intergenic
1136243603 16:28959897-28959919 AACGAAATACACAAATTGGGTGG + Intronic
1136937401 16:34485097-34485119 AATGAAATGGAGAAATTGAATGG + Intergenic
1136962416 16:34863450-34863472 AATGAAATGGAGAAATTGAATGG - Intergenic
1137086855 16:36136110-36136132 AATGAAATGGAGAAATTGAATGG - Intergenic
1137239866 16:46647049-46647071 AATGACTTCCAGAAATTCCAAGG + Intergenic
1137642253 16:50042780-50042802 AATGACATACAGTTAGTGGATGG + Intergenic
1137876587 16:52002455-52002477 AAGGCCATACAGAAATTTTATGG + Intergenic
1138507047 16:57483652-57483674 AAAAAAATACAAAAATTGGAGGG + Intronic
1138517993 16:57548762-57548784 ACTGACACACACAACTTGGATGG - Intronic
1146440180 17:32887093-32887115 AATAACATATACAAATTGGCAGG - Intergenic
1146775457 17:35610458-35610480 AATTACATAAAGAAATTAGTTGG + Intronic
1150069992 17:62142166-62142188 AAAAACATACAGAAATTAGCTGG - Intergenic
1151039672 17:70844056-70844078 TATGACAATCAGAAAGTGGAAGG - Intergenic
1151046407 17:70924897-70924919 CATGACAGACAGAAAATGAAGGG - Intergenic
1153265592 18:3265867-3265889 AAGAACCTACAGAACTTGGATGG + Intronic
1153908968 18:9689757-9689779 GGTGACATACAGAAAATGGAAGG - Intergenic
1154998821 18:21666981-21667003 ATTGACATAGTGAAATTGGGTGG - Intronic
1155346723 18:24864801-24864823 AAAGACAGACATAAGTTGGAGGG - Intergenic
1156665348 18:39398729-39398751 AATAAAATACAGAAATTAGCTGG - Intergenic
1156787600 18:40934320-40934342 AATGAAAAGCAGACATTGGATGG - Intergenic
1156798382 18:41076763-41076785 GATGACATGTAGAAATTGTATGG - Intergenic
1156966392 18:43098932-43098954 GATGACATAGAGAAACAGGATGG + Intronic
1157181632 18:45503473-45503495 AATGGCAAACAGAAAAGGGAAGG - Intronic
1157247290 18:46065759-46065781 AAAGAAATACAAAAATTGGCCGG - Intronic
1157673804 18:49553077-49553099 AGTGACGTACAGAAATCAGAAGG + Intergenic
1158627694 18:59085739-59085761 AAGCACACAGAGAAATTGGAGGG + Intergenic
1159345636 18:67199846-67199868 AATGAAATACAGTCATTGCAAGG - Intergenic
1164436168 19:28231617-28231639 AATGACAGACAGAAGTTGGTGGG - Intergenic
1164994132 19:32707251-32707273 AATAACATAGAGAGATTGGGTGG + Intronic
1166434888 19:42758936-42758958 AATGACCTACAGAGAGTGAAGGG + Intronic
1167173337 19:47848514-47848536 AATGAAGGACAGAAAATGGAGGG - Intergenic
1167359463 19:49022537-49022559 AATTACATAAAGAAATTAGCTGG - Intergenic
1168226288 19:54997612-54997634 AGTGAAATACAGAAATTGGCTGG - Intronic
925827254 2:7861632-7861654 AATGGCCTACAGAAGCTGGAAGG - Intergenic
926071629 2:9898603-9898625 AATGACTTACAGAGAGAGGAAGG - Intronic
926577880 2:14602180-14602202 AATGTCATAGAGTAATTTGAAGG - Intergenic
926661189 2:15468946-15468968 AAATAAATACAGAAATTTGATGG - Intronic
927073880 2:19557249-19557271 AATGACATTCAGATGTTGAAAGG + Intergenic
927595206 2:24390382-24390404 AGTAACAGACAGAAAATGGATGG - Intergenic
928350575 2:30549478-30549500 AAAGAAATTCAGAATTTGGAGGG + Intronic
928993807 2:37264613-37264635 TATGACATGCAGATATTTGAGGG + Intronic
929258011 2:39834199-39834221 ACTGTGATACAGAAATAGGAAGG - Intergenic
929681916 2:44000205-44000227 ACTAAAATACAAAAATTGGAAGG - Intergenic
930986895 2:57600297-57600319 AATGACAAACAGCATTTGTAAGG + Intergenic
931357760 2:61552274-61552296 AATTACATACAAAAATTAGCCGG - Intergenic
931667540 2:64620996-64621018 AATGATACACACACATTGGAAGG + Intergenic
933001378 2:76928061-76928083 AAAGCCATATAAAAATTGGAAGG - Intronic
933195443 2:79384010-79384032 AAGGACGTAGAGAAATTGGATGG + Intronic
933212046 2:79581361-79581383 ACTAACATACAGAAATTAGCTGG + Intronic
933272230 2:80245579-80245601 AATGACAAGCAGGAATGGGATGG - Intronic
933332967 2:80918387-80918409 AAAGACAAACAGAATCTGGATGG - Intergenic
934144666 2:89079801-89079823 AAAGACACAGAGAATTTGGAAGG - Intergenic
934224587 2:90120750-90120772 AAAGACACAGAGAATTTGGAAGG + Intergenic
934510963 2:94942839-94942861 AAAGACATACACAAAGTGAAGGG + Intergenic
935214722 2:100967110-100967132 AATTACATTCAGCAATTGAAAGG + Intronic
935265754 2:101392453-101392475 AATGACACACAGAAGGAGGAAGG + Intergenic
935703394 2:105834522-105834544 AAAGACACACAGAGACTGGAAGG - Intronic
935987061 2:108685210-108685232 AATGACACTCTTAAATTGGAAGG + Exonic
936869381 2:117116252-117116274 GATGATTTCCAGAAATTGGATGG - Intergenic
937747912 2:125437042-125437064 AATGACTTACAGTAATTGAGGGG - Intergenic
938984160 2:136557070-136557092 AATCACAAACACAGATTGGATGG - Intergenic
939087121 2:137734496-137734518 AAAGACATAGAGTAACTGGATGG - Intergenic
939909026 2:147957021-147957043 AAAGACCTACAGACTTTGGAAGG + Intronic
941354614 2:164474197-164474219 ATTAACATACAGAAATTAGGGGG + Intergenic
941577167 2:167247783-167247805 AATGACCACCAGAAAATGGAGGG + Exonic
942651494 2:178173590-178173612 AATGCAATACAGAAATTAAACGG - Intergenic
944340564 2:198592319-198592341 AATGACATAAAGAAGTGAGATGG + Intergenic
944613471 2:201435216-201435238 AAAGACATACAAAAATTAGCTGG - Intronic
944692471 2:202170321-202170343 AGTGAGAAACAGAGATTGGAAGG - Intronic
945557349 2:211295781-211295803 GATGACATACAGAAGTTTGTGGG - Intergenic
945661894 2:212696654-212696676 ATTGACACTCAGAAATTTGAGGG + Intergenic
946511225 2:220358697-220358719 AATGACATACATGAAATGGATGG + Intergenic
947196278 2:227571219-227571241 AATAACAGGCAGAAACTGGAGGG + Intergenic
948173143 2:235922509-235922531 AAAGACAGACCAAAATTGGAAGG + Intronic
1170392186 20:15887599-15887621 AATAACAGACAGGAATTGGTTGG + Intronic
1171169323 20:23001339-23001361 AATGACAGACAGGACTTGGTGGG + Intergenic
1171536248 20:25893634-25893656 AATGACATAGAAAAATGGGTGGG + Intergenic
1171804851 20:29667523-29667545 AATGACATACAAAAATGGGGGGG - Intergenic
1172533960 20:35656366-35656388 ACTGAAATACTGAAATTTGAGGG - Intronic
1174028430 20:47599602-47599624 GATGTCATACAGAAATTTTATGG + Intronic
1175776576 20:61657631-61657653 AAAGATCTACAGAAGTTGGATGG + Intronic
1177925184 21:27205274-27205296 ATGGACAGAGAGAAATTGGAAGG - Intergenic
1179029522 21:37708450-37708472 AATGAGATAGACATATTGGAAGG + Intronic
1181671198 22:24426331-24426353 AAGGACAGACAGAAGATGGATGG + Intronic
1183541291 22:38430860-38430882 AAGGACATCCAGAGATAGGAAGG + Intronic
1185124054 22:48994888-48994910 AATGAAATACAGGTATTGAAAGG - Intergenic
949254562 3:2030425-2030447 AAATTCACACAGAAATTGGAAGG + Intergenic
949801471 3:7909020-7909042 AATAACTTACAGAAAATGGTGGG - Intergenic
952853691 3:37750349-37750371 AATCACATACAGAAACTCTAAGG - Intronic
954011793 3:47646679-47646701 AATGAAGTGCAGAAAATGGAGGG - Intronic
955031164 3:55220661-55220683 ACTGAAAGACAGAAATTGGCAGG - Intergenic
955684776 3:61538957-61538979 AAAAAAATACAGAAATTAGACGG - Intergenic
956349427 3:68318356-68318378 CATTATATGCAGAAATTGGAAGG + Intronic
956746410 3:72314464-72314486 AATGACAGACAGCAGTTGGTGGG + Intergenic
956876067 3:73464562-73464584 AACAAGATACAGAAACTGGAAGG - Intronic
958565953 3:95810544-95810566 AGTGACATACAGAAAACAGAAGG + Intergenic
959247347 3:103889506-103889528 AATGACATTAAGAAACTGGCAGG - Intergenic
960363075 3:116737301-116737323 AATGACATGAAGAAATACGATGG - Intronic
960964859 3:123097698-123097720 AAGGACATGAAGAAAATGGAGGG - Intronic
961117813 3:124346791-124346813 AATCACATAAAGATATTGGCAGG - Intronic
961258715 3:125581812-125581834 AAAAAAATACAGAAATTAGATGG + Intronic
962658186 3:137570876-137570898 ATTTACATACATGAATTGGAAGG - Intergenic
962808274 3:138941932-138941954 CAGGACATTCAGAAATTGGCTGG + Intergenic
963076769 3:141354498-141354520 ACTGAAATGGAGAAATTGGATGG + Intronic
963670073 3:148240257-148240279 AAGCACATACATAAATTAGAAGG + Intergenic
964786716 3:160403514-160403536 AATTACATAATGAAATTGGGAGG + Intronic
965119510 3:164534466-164534488 AATAACATGCAGACATTGGCTGG + Intergenic
965987009 3:174766437-174766459 AATGAAATACAGGTATGGGATGG + Intronic
968086731 3:195877243-195877265 AATGACATACTGAGACTGCAGGG - Intronic
968146148 3:196300565-196300587 ACTGAAATACAGAAATTAGCCGG + Intronic
969142021 4:5084105-5084127 ATTTAAATACAGAGATTGGAGGG - Intronic
971055921 4:22912372-22912394 AAGGACAGACAGAAAGTGGAAGG - Intergenic
971371263 4:26020968-26020990 AATGACATACAGACATTTGGGGG - Intergenic
972088105 4:35244942-35244964 AATGACATCCAGAGATGAGAAGG - Intergenic
972496250 4:39637859-39637881 AATAACACACACAAACTGGAAGG + Intronic
975731909 4:77345854-77345876 AATGATATACTTAAAATGGAAGG + Intronic
976060321 4:81120237-81120259 AGTGACGTACAGAAATCGGAAGG - Intronic
976135228 4:81928951-81928973 ACTAACAAACAGAATTTGGAGGG - Intronic
976435218 4:85010251-85010273 ATTGACAAACAGAAATAGTATGG - Intergenic
977351720 4:95897227-95897249 AATAACATTCAAAAATTGGGAGG + Intergenic
977686350 4:99851332-99851354 AATGAGAGACAGAAAGAGGAAGG + Intronic
977934246 4:102783100-102783122 AATGACTCACAGAATTTGCATGG + Intergenic
979388953 4:120104174-120104196 TATGACACACATAAATTGGTTGG - Intergenic
979405392 4:120304442-120304464 TATGACAGACAGAATTTTGATGG + Intergenic
979409327 4:120356370-120356392 AATGTCATCCAAAAATTGGGAGG - Intergenic
979548636 4:121965080-121965102 AAAGTCATAGAGAAATTGGGAGG - Intergenic
979789357 4:124758816-124758838 AATGTGATACACAATTTGGAAGG + Intergenic
979806998 4:124986404-124986426 AATAACCTACTTAAATTGGATGG - Intergenic
980902386 4:138917222-138917244 AAAGTGATAAAGAAATTGGATGG - Intergenic
980981526 4:139658458-139658480 AAGGACAGACAGACATGGGAGGG - Intergenic
982224768 4:153155402-153155424 AAGAATATGCAGAAATTGGAGGG + Intronic
982236756 4:153258252-153258274 AATGGCATTCAGAATTCGGAGGG - Intronic
983019785 4:162661288-162661310 AGTGACATACAGAAAATGGAAGG + Intergenic
983641728 4:169949605-169949627 AATTACATACAAAAATTAGCCGG - Intergenic
983877240 4:172892077-172892099 AATAAAATCCAGAATTTGGATGG - Intronic
984483955 4:180342276-180342298 AATGACAAAGAGAAAATGAAAGG + Intergenic
985129750 4:186727172-186727194 ATTCACATCCAGAAGTTGGAGGG - Intergenic
985331282 4:188838635-188838657 AATCTCATAAATAAATTGGAAGG + Intergenic
986014076 5:3742087-3742109 AATGGCATTCAGAATTTTGAGGG + Intergenic
987701635 5:21407377-21407399 AAAGACATCCAGAAATTCCATGG + Intergenic
988358260 5:30203707-30203729 AATTACTTACAGAATTAGGAAGG + Intergenic
988691594 5:33577872-33577894 CATGGCATACAGAATGTGGAGGG - Intronic
989688563 5:44115665-44115687 CATGAGGGACAGAAATTGGAAGG + Intergenic
991964547 5:72078171-72078193 AACCAAATACAGAGATTGGAGGG + Intergenic
992940226 5:81753054-81753076 AATGACCTACAGTTATTGGGTGG + Intergenic
993326300 5:86542208-86542230 TTTTACATAAAGAAATTGGAGGG - Intergenic
994763749 5:103889723-103889745 ACTGACATACAGAAATAGATTGG - Intergenic
995458742 5:112379963-112379985 AATAAAATAGAGAAATTGTATGG - Intronic
995670151 5:114594045-114594067 GATGACCTACAGAAGTTGGGTGG - Intergenic
997731424 5:136181812-136181834 AATGACAGCCCAAAATTGGATGG + Exonic
998097843 5:139407008-139407030 AATGACTTAAAAAAATTGGGGGG - Intergenic
998253740 5:140569441-140569463 GATGACAGGCAGAAATTGTAAGG - Intronic
999554994 5:152730500-152730522 AGTGGCATACAGAAAATAGAAGG - Intergenic
1002924825 6:1599284-1599306 ACTGGCATCCAGAACTTGGAGGG - Intergenic
1003059085 6:2848648-2848670 AATACAATACGGAAATTGGAAGG + Intergenic
1003719437 6:8683876-8683898 TATGACATTGAGAAATTGTAAGG + Intergenic
1004073681 6:12325850-12325872 AATGAAATACATAATTTGGTAGG - Intergenic
1008338675 6:50337423-50337445 AATTGTATACAGCAATTGGATGG - Intergenic
1009025210 6:57991338-57991360 CATGACATACAAAATTTGAAAGG + Intergenic
1009200783 6:60742790-60742812 CATGACATACAAAATTTGAAAGG + Intergenic
1010063757 6:71655979-71656001 CATTACATTCAGAAATTGGTGGG + Intergenic
1010144287 6:72648397-72648419 AATACCATACAGTAATTGAAAGG + Intronic
1011687128 6:89832482-89832504 AATGTCATACAGAAAAGGCATGG - Intronic
1011863433 6:91790030-91790052 AATGACATTCACACAGTGGATGG + Intergenic
1011928466 6:92677637-92677659 ATTAACATACAGAACTTAGATGG + Intergenic
1012188132 6:96247351-96247373 TATAACATAAAGCAATTGGAGGG + Intergenic
1012262172 6:97100339-97100361 AAGGATATACATAAATTTGATGG - Intronic
1013116536 6:107107851-107107873 AATGAAACATAGAAACTGGAGGG + Intronic
1013359121 6:109377459-109377481 ATTAAAATACAGAAAATGGATGG + Intronic
1014353839 6:120378830-120378852 AATGACATACAGGAATTACATGG - Intergenic
1014550167 6:122781123-122781145 GTTCACATACAGAAATGGGATGG + Exonic
1014590581 6:123262697-123262719 AATGAGACACAGAAATGTGAAGG - Intronic
1016069374 6:139721255-139721277 AATGACAAAAAAAAATTTGAAGG - Intergenic
1016568336 6:145484570-145484592 AATTACATACAGAATGTAGATGG - Intergenic
1016679299 6:146809500-146809522 AAAAAAATACAGAAATTGGCCGG - Intronic
1018221909 6:161589605-161589627 AATTACATACACAAAATAGATGG - Intronic
1018254551 6:161904946-161904968 AATGTCAATCAGAAATTGGGAGG - Intronic
1018585671 6:165355238-165355260 AATGAAATGCATAAATTTGAAGG + Intronic
1019750849 7:2728782-2728804 AATGTGTTACAGAATTTGGAAGG + Exonic
1020120172 7:5498730-5498752 AAAAACATACAGAAATTAGCGGG - Intronic
1020682959 7:11259303-11259325 AAGGACAGCCAGAAATAGGAAGG - Intergenic
1021010089 7:15451828-15451850 AATGACGTACAGAAATGGGAAGG + Intronic
1021019464 7:15578571-15578593 AATGATATATAGAAAACGGAAGG + Intergenic
1021091093 7:16483736-16483758 AAAAACATACAGAAATTAGCTGG + Intronic
1021607695 7:22425727-22425749 AATGAACTGCAGGAATTGGAAGG + Intronic
1021833098 7:24638302-24638324 AAGAAAATACAGAAATTGAAGGG - Intronic
1022929824 7:35099323-35099345 AATGACATAGAAAAATGGGGGGG - Intergenic
1023765573 7:43507423-43507445 AAGGACATTAAGAAATTGGAAGG + Intronic
1024962008 7:54986637-54986659 AAGGACACAAAGAAATGGGATGG + Intergenic
1025287725 7:57680338-57680360 AATGACATAGAAAAATGGGGGGG + Intergenic
1030440054 7:109578078-109578100 AATGAGAGACAAAAATTGCATGG - Intergenic
1031336993 7:120547543-120547565 AACAACAGAGAGAAATTGGAGGG - Intronic
1031833546 7:126655060-126655082 AAGAACATACATAAAATGGATGG + Intronic
1032748273 7:134810014-134810036 GATGACTTACAGAAATAGTAAGG + Intronic
1033284790 7:140031818-140031840 AATGACTTCCAGAAATAGGAGGG + Intronic
1035868263 8:3108919-3108941 AATGAAAGACAGAGACTGGAGGG - Intronic
1036044095 8:5120310-5120332 AATTCCAAACAGAAAGTGGAGGG + Intergenic
1037379290 8:18267069-18267091 CCTGACTTACAGAAATTGCAAGG + Intergenic
1037451171 8:19016421-19016443 AGTGACCTTCAGAAATAGGAAGG - Intronic
1038600309 8:28934627-28934649 AATAATATACAGAAATTGGCCGG + Intronic
1038801819 8:30756300-30756322 AAAGACATACAAAAATTAGCTGG - Intronic
1039301418 8:36213198-36213220 AATGAGATGCCGAAAGTGGAAGG - Intergenic
1039333539 8:36564924-36564946 AATGACACACAAATATTAGAAGG + Intergenic
1039995073 8:42525170-42525192 AAGGAAATACAGAAAAAGGAAGG + Intronic
1040652187 8:49461724-49461746 AATGGCAAAGAGAAAATGGAAGG + Intergenic
1040777677 8:51066523-51066545 AATGACCTAAATAAATTGAAAGG + Intergenic
1040828610 8:51651801-51651823 AGTGTCATCCAGAAACTGGAAGG + Intronic
1041823938 8:62069805-62069827 AATATCAAACAGAAATTAGAAGG + Intergenic
1041828349 8:62124047-62124069 AATGGCATAGAGACATGGGAGGG - Intergenic
1042083160 8:65077987-65078009 AAAGACAAACAGAAATAGAAAGG + Intergenic
1042848903 8:73195859-73195881 AATAACATACCAAAATTGGAGGG + Intergenic
1043775260 8:84259310-84259332 CATGGAATACAGAAGTTGGAGGG - Intronic
1043964590 8:86459627-86459649 AAATACATACATAAATAGGAAGG + Intronic
1045239457 8:100386437-100386459 CATCAGATACAGAAAGTGGAAGG - Intronic
1045920472 8:107523047-107523069 AAGGACAGATAGAATTTGGATGG + Intergenic
1046297414 8:112239144-112239166 AGTGACGTACAGAAATCAGAAGG - Intronic
1046867510 8:119167246-119167268 AGTGACGTACAGAAAATGGAAGG + Intronic
1047539441 8:125750242-125750264 ACTGCCACACAGAAAATGGAGGG - Intergenic
1048420757 8:134276009-134276031 AATGAGATTCAGAAATTTAAAGG - Intergenic
1048870754 8:138795400-138795422 AATGACACAAAGAAATGTGAGGG + Intronic
1050302765 9:4276122-4276144 AAAGAAATACAGAAATTAGCCGG + Intronic
1050311403 9:4356500-4356522 AATGACTGACAGATATTAGATGG + Intergenic
1050987188 9:12097900-12097922 AAAGGAATACAGAAAGTGGATGG - Intergenic
1052157201 9:25207009-25207031 AATGGCATACACAAAGTGTAGGG - Intergenic
1053207653 9:36200528-36200550 ACTGACACCCAGAAATAGGAAGG + Intronic
1058027608 9:100159366-100159388 AATGACATACAGATAGTCAATGG + Intronic
1058064798 9:100537292-100537314 TATGAGATACTGAATTTGGAGGG + Intronic
1060378041 9:123136213-123136235 AAGGACATAGAGGAATTGCATGG - Intronic
1060863271 9:126974032-126974054 TATGACATACAAAAATTAGCCGG - Intronic
1185741458 X:2536333-2536355 AATGACATACAGAAATCAGCAGG + Intergenic
1186149012 X:6654685-6654707 AATGACGTACAGAAATTAATTGG + Intergenic
1188410241 X:29863107-29863129 AATGAGATACAGAAAGTTTATGG - Intronic
1188946723 X:36314416-36314438 AGTGACATACAGAAAACAGAAGG + Intronic
1189261859 X:39684884-39684906 AGTGACGTACAGGAATCGGAAGG - Intergenic
1189686937 X:43574211-43574233 AAAGACATACAGAATTTTGATGG - Intergenic
1190226632 X:48551034-48551056 AATGCCAGTCAGAAATTGAATGG - Intronic
1190517435 X:51238338-51238360 AAAGACATAGAGTAATTGAATGG + Intergenic
1190980331 X:55451980-55452002 AATGACAGCTAGAGATTGGAGGG - Intergenic
1191166086 X:57393560-57393582 AATCTCATGCAGAGATTGGAGGG - Intronic
1193313513 X:80037267-80037289 AATGACATACAGAAACAGCTGGG + Intergenic
1193570461 X:83135465-83135487 AAAGACATAGAGAATGTGGAAGG + Intergenic
1194984115 X:100471640-100471662 GATGAGATACAGAAATAGGAAGG + Intergenic
1196486683 X:116218653-116218675 AATGAAATACAAAAATTAGCTGG + Intergenic
1197646791 X:129026848-129026870 AATGATATACTGAAATTTAATGG - Intergenic
1197922920 X:131614521-131614543 AATCACATGCAGAGATTGCAAGG + Intergenic
1198264245 X:134994722-134994744 AAAGAGAAAAAGAAATTGGAAGG + Intergenic
1198940971 X:141954677-141954699 CATGACTTACACAAACTGGAGGG + Intergenic
1199280655 X:145996063-145996085 AGTGAGATACGCAAATTGGAGGG - Intergenic
1201015943 Y:9601485-9601507 AATGACATAAAGAATTAGGTAGG - Intergenic