ID: 1125436893

View in Genome Browser
Species Human (GRCh38)
Location 15:39655715-39655737
Sequence GGGCATCTGAATAAGGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 310
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 283}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125436893_1125436902 -2 Left 1125436893 15:39655715-39655737 CCATCCTCCTTATTCAGATGCCC 0: 1
1: 0
2: 1
3: 25
4: 283
Right 1125436902 15:39655736-39655758 CCTACTGGGAGGAAGGTGCGTGG 0: 1
1: 0
2: 0
3: 30
4: 648
1125436893_1125436903 -1 Left 1125436893 15:39655715-39655737 CCATCCTCCTTATTCAGATGCCC 0: 1
1: 0
2: 1
3: 25
4: 283
Right 1125436903 15:39655737-39655759 CTACTGGGAGGAAGGTGCGTGGG 0: 1
1: 0
2: 1
3: 13
4: 146
1125436893_1125436904 11 Left 1125436893 15:39655715-39655737 CCATCCTCCTTATTCAGATGCCC 0: 1
1: 0
2: 1
3: 25
4: 283
Right 1125436904 15:39655749-39655771 AGGTGCGTGGGTCAACCTAGAGG 0: 1
1: 0
2: 0
3: 1
4: 42
1125436893_1125436899 -9 Left 1125436893 15:39655715-39655737 CCATCCTCCTTATTCAGATGCCC 0: 1
1: 0
2: 1
3: 25
4: 283
Right 1125436899 15:39655729-39655751 CAGATGCCCTACTGGGAGGAAGG 0: 1
1: 0
2: 1
3: 19
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125436893 Original CRISPR GGGCATCTGAATAAGGAGGA TGG (reversed) Intronic
901090240 1:6636012-6636034 GGGCAGCTGAGGAAGGTGGAAGG + Intronic
901916172 1:12502331-12502353 TGGAATCTGAGTGAGGAGGAGGG + Intronic
902963691 1:19982527-19982549 GGGTATCTGGAGTAGGAGGATGG + Intergenic
903099012 1:21011481-21011503 GGAAATCTGAATAAGGTTGATGG - Intronic
903826287 1:26147854-26147876 GTGCATCTGGACAGGGAGGATGG + Intergenic
904115716 1:28160461-28160483 GGGAAACTGAGGAAGGAGGATGG + Intronic
904576697 1:31509493-31509515 GGGCGTCTGAAGCAGGAGTAGGG - Intergenic
904724657 1:32538031-32538053 GGGCAGCTGAACCAGGAGAATGG - Intronic
906855689 1:49301962-49301984 AGGCAGCTGAGCAAGGAGGATGG - Intronic
906874774 1:49525564-49525586 GGGCATGGAAATAAAGAGGAGGG + Intronic
908056211 1:60289906-60289928 GTGCATCTGAATAATGGGAAAGG - Intergenic
908393527 1:63704598-63704620 GGACACCTGAGGAAGGAGGAAGG - Intergenic
909055874 1:70820520-70820542 GGGCATATGGAGAAAGAGGAAGG + Intergenic
911587686 1:99709861-99709883 GGGAATCTGAATCAGGTGGATGG + Intronic
913518460 1:119624092-119624114 GGGCAGCTGAGTGAGGAAGAAGG - Exonic
916279037 1:163028325-163028347 GGGGATCTGACTGTGGAGGAAGG + Intergenic
917793674 1:178516223-178516245 GGGGAAGTGAATAAGGAAGATGG - Intronic
918561950 1:185879671-185879693 GAGCATCTGAGTAAAGAGGCTGG + Intronic
918771173 1:188562222-188562244 AGACATCTGAAGAAGGTGGAAGG + Intergenic
921273302 1:213491581-213491603 GGGCACCTGAGTCAGGAGCAAGG + Intergenic
924311212 1:242744966-242744988 TGACATCTGAATACGGAGGGAGG - Intergenic
1062941963 10:1428921-1428943 GGAAATCTGAATAAGGTGGGTGG + Intronic
1064084924 10:12338298-12338320 GTGTTTCTGAAAAAGGAGGAAGG - Intergenic
1064818807 10:19299897-19299919 AGGCATCTGAATAAGAAGAGAGG + Intronic
1066074347 10:31858097-31858119 GGGAGTCTGAAGCAGGAGGATGG + Intronic
1066631513 10:37463164-37463186 AGGCATTTGAATGAAGAGGAGGG - Intergenic
1067031754 10:42882788-42882810 GGGCAGCTGAGTGAGGAGGCAGG + Intergenic
1067535054 10:47102964-47102986 TGCCATCAAAATAAGGAGGAAGG + Intergenic
1069409905 10:68142448-68142470 AGCCATCAGAGTAAGGAGGAGGG - Intronic
1070303623 10:75224141-75224163 TGGCATCTGAAGTGGGAGGAGGG + Intronic
1070324428 10:75378572-75378594 AGGCCTCTGAATGATGAGGATGG - Intergenic
1071015500 10:80992666-80992688 GGGCATCTGAATCAGTAGAGAGG - Intergenic
1071529251 10:86376776-86376798 AGGGAGTTGAATAAGGAGGAAGG + Intergenic
1071549600 10:86556524-86556546 TGACAGCTGAATAATGAGGAGGG + Intergenic
1073791151 10:106941742-106941764 GGGCTTCAGAGTAAGGAGCAGGG + Intronic
1074004946 10:109412050-109412072 GGTCATGTGAATAAGCAGCACGG + Intergenic
1074419922 10:113299732-113299754 AGCCACCTGAATGAGGAGGAAGG + Intergenic
1074747318 10:116547619-116547641 GGGAAACTGAAGCAGGAGGATGG + Intronic
1074953620 10:118365470-118365492 GGGAATCTGCATATGGAAGAAGG + Intergenic
1077315149 11:1916420-1916442 GGGCATCTGAGAAAGGATGGGGG - Intergenic
1077819241 11:5719774-5719796 GGGCATTTGCTGAAGGAGGATGG - Intronic
1079362039 11:19777420-19777442 GGGCAGAGGAAAAAGGAGGAGGG - Intronic
1079618068 11:22519476-22519498 TGGCATCTGACTAAGGTGGCAGG + Intergenic
1081173818 11:39901488-39901510 GGGCATATGAAAAAAGAGGAAGG - Intergenic
1083061536 11:59877871-59877893 GGGCTGCTGATGAAGGAGGAGGG - Intergenic
1083580113 11:63819161-63819183 GGGGATCTGAATGATGAGGAAGG + Intronic
1084142633 11:67243312-67243334 TGGCATCTGAATCTGGAGGGAGG - Intronic
1086410403 11:86539117-86539139 GGGGTTGTTAATAAGGAGGAAGG + Intronic
1086914278 11:92510908-92510930 GGGCATCCTCATGAGGAGGAGGG + Intronic
1089635704 11:119810269-119810291 GGGCATCAGAATGGAGAGGAAGG + Intergenic
1090309354 11:125721133-125721155 GGTCATGTGGATAAGGAGAAGGG - Intergenic
1091296559 11:134477892-134477914 GGGCATCTCAAATAGAAGGATGG + Intergenic
1091323895 11:134669945-134669967 GGGCTTCTGATGAAGGTGGAAGG + Intergenic
1091985593 12:4908676-4908698 TGGCGTCTGAATCTGGAGGAAGG + Intergenic
1092013687 12:5138829-5138851 GGCCATCAGAGAAAGGAGGATGG + Intergenic
1092120547 12:6040716-6040738 TGGCATGGGAATGAGGAGGATGG - Intronic
1092233903 12:6793568-6793590 AGGTTTCTGAAAAAGGAGGAAGG - Intronic
1095667588 12:44820269-44820291 TGGCATCAGAATAAACAGGAGGG + Intronic
1096665417 12:53160904-53160926 GGGGACCTGGAAAAGGAGGAAGG - Intronic
1096720598 12:53518560-53518582 GGGAGTCTGAAGCAGGAGGATGG - Intronic
1097207572 12:57335826-57335848 GGGAAGCTGAAGCAGGAGGATGG + Intronic
1097698634 12:62798689-62798711 TGGCAGGTGAATGAGGAGGAAGG - Intronic
1099104796 12:78484774-78484796 GCTCATGTGAATAAGGAGGGGGG - Intergenic
1101615962 12:106337403-106337425 GAGCATCAGAATCAGGAGAAAGG - Intronic
1104229306 12:126868758-126868780 GGGCATCCAAATAAGAAGAAAGG - Intergenic
1104534901 12:129609714-129609736 GGGCATCTGACTGGGGAAGAGGG - Intronic
1106656464 13:31752243-31752265 AGTCATCTGAAGAAGGAGGGGGG + Intronic
1106858905 13:33883551-33883573 GGGAATCTGAATGAGGCTGAAGG + Intronic
1108200899 13:48042005-48042027 GGGCAGCTGCATGAGGAGGACGG + Intronic
1109994823 13:70108966-70108988 GGGCATCTGAACACGGGGGACGG + Intergenic
1111508364 13:89226383-89226405 TGAAATCTGAATAAGGTGGATGG + Intergenic
1111535594 13:89598631-89598653 GGGAATCTGAGGCAGGAGGATGG - Intergenic
1113010333 13:105757907-105757929 TGGGATCTGCATTAGGAGGAAGG - Intergenic
1113271270 13:108677129-108677151 GGGGATGTGCAGAAGGAGGAGGG + Intronic
1113855653 13:113444176-113444198 GGGCATCTGTTTAAGGACTATGG - Intronic
1113871850 13:113564679-113564701 GAGCATCTGAAGGAAGAGGAGGG - Intergenic
1116927960 14:50660354-50660376 AGGCAGCTGAGTAAGGAGGATGG - Intronic
1118157450 14:63255594-63255616 GTGCATTTGAATCAGGAGCATGG - Intronic
1123753500 15:23377950-23377972 GGGAAGCTGAAGCAGGAGGATGG + Intergenic
1125436893 15:39655715-39655737 GGGCATCTGAATAAGGAGGATGG - Intronic
1125598946 15:40905135-40905157 GGGAGTCTGAGGAAGGAGGATGG + Intergenic
1126168340 15:45672895-45672917 GTGCATCTGAATCAGCTGGAGGG + Intronic
1127814191 15:62592091-62592113 GGGGATGTGTATAAGGAGGAGGG + Intronic
1128802744 15:70507281-70507303 GGGCAACAGACCAAGGAGGATGG - Intergenic
1131175989 15:90210154-90210176 GGACTTCTGAGGAAGGAGGATGG + Intronic
1131209001 15:90477086-90477108 GGGCATCTGAAAAATGAGCTTGG - Exonic
1133067677 16:3220959-3220981 GGGAAGCCGAATCAGGAGGATGG - Intergenic
1133318477 16:4898545-4898567 GGCCATGTGAAGACGGAGGAAGG + Intronic
1134231295 16:12432531-12432553 GGGCATCCTAAGAAGGGGGATGG + Intronic
1135096062 16:19565732-19565754 GGGAACCTCACTAAGGAGGAAGG - Intronic
1135338203 16:21622247-21622269 GGGCAGCTGAGGCAGGAGGATGG - Intronic
1135718637 16:24795114-24795136 TGACAGGTGAATAAGGAGGATGG - Intronic
1136271011 16:29148251-29148273 GGGCTTCTGATTCAGGAGGCTGG + Intergenic
1136392472 16:29974185-29974207 GGGTATCTGAGAAAGGAGGAGGG - Exonic
1136999065 16:35213135-35213157 AGGCTTCAGAATAAGGAGGAAGG - Intergenic
1137449198 16:48555083-48555105 GGGCATTTGAAGAAGGAGCAAGG - Intronic
1137759847 16:50931688-50931710 GGACAACTGAATATGGAGGCAGG + Intergenic
1137805180 16:51297861-51297883 GGGCATCAGAATGAGGAGTGGGG + Intergenic
1138372466 16:56538124-56538146 GGGCATATGTATAAGAAGGGAGG - Intergenic
1141071425 16:80958824-80958846 GGGCATCTAAATAGGAAGAAAGG + Intergenic
1141096389 16:81165958-81165980 GGCAATCTGAAAAAGGAGGCAGG + Intergenic
1142074623 16:88110260-88110282 GGGCTTCTGATTCAGGAGGCTGG + Intronic
1143714162 17:8755167-8755189 GGGAACCTGGAGAAGGAGGATGG + Intronic
1143733223 17:8893194-8893216 GGGCTTCTGAATAAGCCTGAGGG + Intronic
1143850302 17:9806269-9806291 GGGCAGCCCAATAAGGAGGTGGG - Intronic
1146196892 17:30820948-30820970 GGGGATCTGAGACAGGAGGATGG + Intronic
1146397135 17:32477380-32477402 GGGCGTCTGAAGAAGAACGATGG + Intronic
1146866521 17:36339919-36339941 GGGAAGCTGAAATAGGAGGATGG - Intronic
1147069391 17:37940523-37940545 GGGAAGCTGAAATAGGAGGATGG - Intergenic
1147080919 17:38020063-38020085 GGGAAGCTGAAATAGGAGGATGG - Intronic
1147096862 17:38144020-38144042 GGGAAGCTGAAATAGGAGGATGG - Intergenic
1147976845 17:44252908-44252930 GGGCGTCTGAGCAGGGAGGAAGG - Intronic
1148203006 17:45762464-45762486 GGGCATCTGACTGGGGAGAAGGG + Intergenic
1148283088 17:46364051-46364073 GGGCATCTGAATGAGGAGATGGG - Intergenic
1148305305 17:46581976-46581998 GGGCATCTGAATGAGGAGATGGG - Intergenic
1148489909 17:48016391-48016413 AGGCAGCTGTATATGGAGGAAGG - Intergenic
1149290697 17:55215239-55215261 GGCCATCAGAACAAGAAGGATGG - Intergenic
1149543221 17:57484211-57484233 GGGCATCTGCCTGAGGAGCAGGG - Intronic
1149844947 17:60002957-60002979 GGGAAGCTGAAGTAGGAGGATGG + Intergenic
1149890014 17:60380461-60380483 GGGAAGCTGAAATAGGAGGATGG + Intronic
1153921051 18:9790473-9790495 GGGAAGCTGAAGCAGGAGGATGG - Intronic
1154094207 18:11395470-11395492 GGAGATCTGAAAAAGGAAGAAGG - Intergenic
1154366610 18:13716281-13716303 GGGCCTCTGAAGAGGGAAGAGGG - Intronic
1155137014 18:23005858-23005880 TTGCATCTGCATAATGAGGAGGG - Intronic
1158558776 18:58496547-58496569 AGGAATCTGAAAAAGTAGGAAGG - Intronic
1158610968 18:58940490-58940512 GGGCAGCTTAACAAAGAGGAGGG + Intronic
1160301969 18:77690193-77690215 TGGTGTCTGAATAAGGAGAACGG - Intergenic
1161752444 19:6108358-6108380 GTCCTTCTGGATAAGGAGGAGGG - Intronic
1162569029 19:11460225-11460247 TGGATTCTGGATAAGGAGGAAGG - Intronic
1162880562 19:13655850-13655872 GGGCAGCTGAATGAGGAGTTGGG + Intergenic
1163577689 19:18120242-18120264 GGGCATCTTGAGAAGAAGGAGGG + Intronic
1167645050 19:50701118-50701140 GGGCCCCTGAATAAGCAGGGAGG - Intronic
1167665533 19:50821120-50821142 GGGCAACTGAGGGAGGAGGAAGG - Intronic
1168028114 19:53658397-53658419 GCGAAACTGAATCAGGAGGAAGG + Intergenic
927681348 2:25141471-25141493 GGGCAGCTGAGTAAGCAGGTGGG + Intronic
928271338 2:29858000-29858022 GGGAATCTGAATAAGGTTGTTGG - Intronic
929140203 2:38660442-38660464 GGGAGGCTGAATCAGGAGGAAGG + Intergenic
929458647 2:42085019-42085041 GGGAAGAAGAATAAGGAGGAGGG + Intergenic
929680839 2:43992192-43992214 GGACACCTGACTAAGGGGGAAGG + Intronic
930476066 2:51883817-51883839 AGGCATCTAAATAAGGAGAGAGG - Intergenic
930798531 2:55419348-55419370 AGGCATCTGGAGGAGGAGGAAGG + Exonic
931910521 2:66894671-66894693 GGACATCTGTTTTAGGAGGAAGG + Intergenic
932039434 2:68283601-68283623 GGGAAGCTAAATAAGGATGATGG - Intergenic
932184567 2:69682089-69682111 GGGAGGCTGAATCAGGAGGATGG - Intronic
933143383 2:78821463-78821485 GGGAATTTCAATAAGGAGAATGG - Intergenic
933439459 2:82293238-82293260 GGGCATCCAAATAAGAAGGGAGG - Intergenic
934948326 2:98558267-98558289 GAGCTTATGAATGAGGAGGAAGG - Intronic
936092898 2:109512327-109512349 GGGCATCAGAAGAAGGAGGAAGG - Intergenic
938238703 2:129726339-129726361 AGGAATCTGAGTAAGGAGAAAGG - Intergenic
938285297 2:130109232-130109254 TGGCTTCTGCATAAGGAGGCAGG - Intronic
940952582 2:159692911-159692933 GGGAAACTGAGAAAGGAGGATGG - Intergenic
941242425 2:163055924-163055946 GGGAATGTTAATAATGAGGAAGG - Intergenic
942693500 2:178612571-178612593 GAGGATCTGAAAAAGAAGGAAGG + Exonic
943458453 2:188138093-188138115 GGGAATCTGAATAAAGAGTATGG + Intergenic
945148276 2:206761744-206761766 GGGCATCTGATAGAGCAGGAGGG + Intronic
947072237 2:226302384-226302406 TGGCATCTGTCAAAGGAGGAAGG - Intergenic
947176586 2:227373322-227373344 TGGCCTCTAAATAAGGAGGGTGG - Intronic
947599456 2:231436999-231437021 GGGCCTCTGAAAGGGGAGGAAGG + Intergenic
1169425828 20:5496826-5496848 GGGCATCTGATGGATGAGGAGGG - Intergenic
1170235925 20:14105323-14105345 GAGAATCTGAATTTGGAGGAAGG + Intronic
1170635605 20:18101528-18101550 GGGCCTTTGGAGAAGGAGGATGG + Intergenic
1171332349 20:24351495-24351517 GAGAGGCTGAATAAGGAGGAGGG - Intergenic
1171424623 20:25041897-25041919 GGTCACCTGCATGAGGAGGAAGG + Intronic
1172922353 20:38495811-38495833 GGCCTTCTGAATGAGGAGGAAGG + Intronic
1173423268 20:42921892-42921914 TGGAATCTGAGAAAGGAGGAGGG - Intronic
1173484847 20:43433442-43433464 GGGGAAGGGAATAAGGAGGAAGG + Intergenic
1173895332 20:46546350-46546372 GGGCATCTCTATCAGGAGGTGGG + Intronic
1174101477 20:48129493-48129515 GGGCATCTCAGTAAGGGGGAAGG - Intergenic
1174806220 20:53606626-53606648 GGGGATCTCAAAATGGAGGATGG - Intronic
1175030336 20:55947274-55947296 GGGAATCTCAAGAAGGAGGAGGG + Intergenic
1175614853 20:60389288-60389310 AGGCTTCTGAATGAGCAGGAAGG + Intergenic
1175831179 20:61966124-61966146 GGCCATCTGCATCCGGAGGAGGG + Intronic
1176293639 21:5059280-5059302 TGGCAGATGAATGAGGAGGAGGG + Intergenic
1177510477 21:22080475-22080497 AGGCTTCTGTATAAGGATGAAGG - Intergenic
1179863621 21:44204368-44204390 TGGCAGATGAATGAGGAGGAGGG - Intergenic
1182520625 22:30882597-30882619 TGGCATCAGAATCAGCAGGAGGG + Intronic
1182575678 22:31271328-31271350 GGGCATTGGAAGAAGCAGGAAGG - Intronic
1182636085 22:31728119-31728141 GGGCTCCTGAATATGGATGAGGG + Intronic
949237541 3:1828251-1828273 GTCCATATAAATAAGGAGGATGG - Intergenic
950129712 3:10533819-10533841 TGGCATTTGAATTAGGAGCATGG - Intronic
951366307 3:21787457-21787479 TAGCATCTGGATAAGGAGTAGGG - Intronic
951548052 3:23848763-23848785 GGGCATCTAAGAAAGGAAGAGGG + Intronic
952022876 3:29044012-29044034 GGGCAGCAGTATATGGAGGATGG - Intergenic
959297415 3:104554689-104554711 AGGCAACTGAATCATGAGGATGG - Intergenic
959403811 3:105936299-105936321 AGGTAACTGAATCAGGAGGATGG - Intergenic
961166453 3:124766958-124766980 GGGCTTCTTAATATGGAGGAGGG - Intronic
961434823 3:126909652-126909674 GGGCAGCTGGAGGAGGAGGAGGG + Intronic
962018804 3:131474400-131474422 GGGGATGGGAATGAGGAGGATGG + Intronic
962314615 3:134351254-134351276 GGGCACCTGGCCAAGGAGGAAGG + Intergenic
964002210 3:151788608-151788630 GGGTATCTGAGGAAGGAGCATGG - Intergenic
965051008 3:163647563-163647585 GTGCATTTGAATAAGGATCATGG - Intergenic
966606329 3:181825082-181825104 TTGCATCTGAATAAGGAACAAGG - Intergenic
967420308 3:189265143-189265165 TTGTATATGAATAAGGAGGAAGG + Intronic
968066918 3:195763956-195763978 TGGCATCTGGATAAGGAGTAGGG - Intronic
968075982 3:195816362-195816384 TGGCATCTGCGTAAGGAGAAGGG - Intergenic
968584403 4:1409405-1409427 GGGGATCTGAGAGAGGAGGAGGG - Intergenic
969432612 4:7164735-7164757 GGGCTTCTGGGTGAGGAGGAAGG + Intergenic
970897953 4:21125145-21125167 GTGCATCAGAATCAGCAGGAGGG + Intronic
972722945 4:41719052-41719074 AGGAATTTGAAAAAGGAGGAAGG + Intergenic
973894807 4:55401045-55401067 GGGCTTCTGAAAATGGAGGGGGG + Intronic
974020359 4:56687569-56687591 GGGCAGGTGAATGTGGAGGAGGG + Intergenic
974258895 4:59498740-59498762 GGGGATGTGAATAATCAGGAAGG + Intergenic
974982325 4:68974004-68974026 GGGAAACTGAATAAGAAGTATGG + Intergenic
975664221 4:76718940-76718962 GGGTTTCTCATTAAGGAGGAAGG + Intronic
979210527 4:118095708-118095730 GTGCAACTGATTAATGAGGATGG - Intronic
982102164 4:151978632-151978654 GGACATCTGCTTATGGAGGAGGG - Intergenic
982504761 4:156203419-156203441 GGGCAGCTGTATAGGGAGCAGGG - Intergenic
982957805 4:161793053-161793075 GGGCAACTGCATATGGATGAGGG - Intronic
983046731 4:162996144-162996166 GGGCAACTGAAGAAGGTGAAGGG + Intergenic
984023432 4:174514693-174514715 GGGCATCTAAATAAGAAGAGAGG + Intronic
984477827 4:180259369-180259391 AATCATCTCAATAAGGAGGAGGG + Intergenic
984775754 4:183480466-183480488 GGGAAGCTGAAGAGGGAGGATGG + Intergenic
985000909 4:185481587-185481609 GGCCATCTGCAGAATGAGGAGGG - Intergenic
985909838 5:2870426-2870448 GGACATCTTAATAAGTAGGAGGG - Intergenic
985938901 5:3118483-3118505 GGGCAACTGCAGAAGGAGGGTGG - Intergenic
987581414 5:19798212-19798234 GGGAATCTGAATAAGGTTGTTGG + Intronic
988660150 5:33257657-33257679 CAGCATATGAATTAGGAGGATGG - Intergenic
989521260 5:42403349-42403371 TAGCATCTGACTAAGGAAGAAGG + Intergenic
993032091 5:82716252-82716274 GGGAAGCTGAAGCAGGAGGATGG - Intergenic
993644453 5:90445399-90445421 GAGCATCTGAAGAAAGAAGAAGG - Intergenic
994533218 5:100992978-100993000 GAGCATCTGAACAAGGAGTTTGG - Intergenic
994774532 5:104026069-104026091 GAGAATCTGGATAGGGAGGACGG - Intergenic
995213466 5:109568014-109568036 GGGCATCTGACTCCAGAGGAAGG - Intergenic
996167551 5:120243626-120243648 GGACATCAGAATAAAGAGGGAGG + Intergenic
996489434 5:124076030-124076052 GGGCATCCAAATAAGAAAGAAGG - Intergenic
997206049 5:132050814-132050836 AGGCATCTGAATGGGGAGGCAGG + Intergenic
997852592 5:137346144-137346166 GGGCATCTGATGCAGGAGAAAGG - Intronic
999633344 5:153594627-153594649 GGGCCTCTAAATATGGAGGAGGG - Intronic
1001427603 5:171633937-171633959 CAGCATCTGAAACAGGAGGATGG - Intergenic
1001767246 5:174260137-174260159 AGGCATCTAAATATGAAGGAGGG + Intergenic
1002302322 5:178264174-178264196 GGGCATCTGAATAAGGTTGGTGG + Intronic
1002401691 5:178994751-178994773 GGGCAGCTGAAGAAGGAGCAGGG - Exonic
1004142215 6:13028789-13028811 GAGCCACTGAATAAGGAGCAAGG + Intronic
1005979988 6:30829341-30829363 GGGCACCTGCAAGAGGAGGAAGG + Intergenic
1006361173 6:33588236-33588258 GGGGATGAGAAGAAGGAGGAGGG - Intergenic
1007834852 6:44666511-44666533 GGGCAGCTGAGTATGGAGCAGGG + Intergenic
1010122095 6:72388239-72388261 AGAAATCTGAATAAGGAGCAAGG + Intronic
1010458857 6:76090123-76090145 GGGCATCTGAATCAGTAAGGAGG - Intergenic
1010559389 6:77330990-77331012 TGCCATCTAAATAAGAAGGAAGG + Intergenic
1013639353 6:112058148-112058170 GGGCTTCTGGAGAAGGAGCAGGG - Intronic
1015022592 6:128494082-128494104 GGGCAGCTGAGGCAGGAGGATGG + Intronic
1015557295 6:134476402-134476424 CTGCATCAGAATAATGAGGAAGG - Intergenic
1015840305 6:137469670-137469692 GGTCATCAGAATAAGAAGTATGG + Intergenic
1016913843 6:149226200-149226222 GGGCACCTGGATTTGGAGGAAGG + Intronic
1017219787 6:151952469-151952491 GGGAATCTGAATAGAGAGAAGGG - Intronic
1018643377 6:165925884-165925906 GGAAATCTGAATATGGTGGATGG + Intronic
1019907927 7:4078821-4078843 AGGCAACTGGATAAGGTGGAAGG - Intronic
1022898589 7:34778323-34778345 GGCCATCTGATAAAGCAGGAAGG + Intronic
1023271706 7:38470114-38470136 GGGGATCAGGACAAGGAGGAAGG - Intronic
1026150421 7:67783642-67783664 TGGGACCTGAATGAGGAGGATGG + Intergenic
1028640549 7:93037971-93037993 AGGCAACTGACTAATGAGGAAGG - Intergenic
1029509004 7:100981553-100981575 GGGCAGCTGGATAAGATGGATGG + Intronic
1031137781 7:117903835-117903857 GGACAACTGACCAAGGAGGAGGG + Intergenic
1032181836 7:129686180-129686202 GGGCAGCTAAAGAAGGAAGAAGG + Intronic
1033657413 7:143382734-143382756 GGGCATAGAACTAAGGAGGATGG + Intronic
1033932318 7:146539280-146539302 GGGTTTCTGAAGAATGAGGAAGG + Intronic
1034835794 7:154350773-154350795 GGGCAGCTGAACAAGGAGACAGG + Intronic
1035840383 8:2805614-2805636 AGGCTTCTGAATAAGGGGAAAGG - Intergenic
1036676170 8:10835509-10835531 GGGCATCTCAATGAGAGGGATGG - Intronic
1037596815 8:20361217-20361239 GGGAATCTGAAGCAGGAGGATGG + Intergenic
1037976564 8:23218060-23218082 GGGCGTCTGATTAAGGGAGATGG + Intronic
1038814091 8:30883213-30883235 GGGAAGCTGAAGCAGGAGGATGG - Intronic
1039062458 8:33582451-33582473 GGGAATCTGAGGCAGGAGGATGG - Intergenic
1040525931 8:48225359-48225381 AGGCATCTGAAAAATGGGGAAGG - Intergenic
1040926619 8:52690765-52690787 GGTGATCTGAGTAAGGGGGACGG - Intronic
1041435727 8:57839373-57839395 GGCAATCTGAATCAGGAAGAGGG - Intergenic
1041571788 8:59345266-59345288 GGGCATATGAATAATCAAGATGG + Intergenic
1042325143 8:67520521-67520543 GGGTATTTGAATAAGCAGCATGG + Intronic
1042333536 8:67607351-67607373 GGGCATCTGAAAGAGTAGGCGGG + Intronic
1045989394 8:108287875-108287897 GGACATCTTAAAAAGGAGGCTGG - Intronic
1046363581 8:113194959-113194981 GGGCAATTGAAGATGGAGGAAGG - Intronic
1047167913 8:122461305-122461327 GGGCTCCTGAGTAAGAAGGAGGG + Intergenic
1047290311 8:123524150-123524172 GGGTATTTGAAGAAGTAGGAGGG - Intronic
1047756611 8:127923747-127923769 GGGCACATGGAGAAGGAGGAAGG + Intergenic
1049497412 8:142942786-142942808 GGGCATGAGAGGAAGGAGGAAGG + Intergenic
1049958778 9:718415-718437 GGGAAGCTGAAGAGGGAGGATGG - Intronic
1052407012 9:28073786-28073808 GGGGAGCTGAAGTAGGAGGATGG + Intronic
1052483950 9:29071294-29071316 GGGAGACTGAAGAAGGAGGATGG - Intergenic
1053448988 9:38177630-38177652 GGGCATCTGCACAGGGAAGAAGG - Intergenic
1054459378 9:65454619-65454641 GGTCATTTGAATAACCAGGAAGG + Intergenic
1055417147 9:76095921-76095943 GGGCATCTGGAAATGGTGGAAGG + Exonic
1059269131 9:113061210-113061232 GGGCAGCTGGAGAAAGAGGAGGG - Intergenic
1059270267 9:113066659-113066681 GGGCAGCTGGAGAAAGAGGAGGG - Intergenic
1059271403 9:113072109-113072131 GGGCAGCTGGAGAAAGAGGAGGG - Intergenic
1059272534 9:113077553-113077575 GGGCAGCTGGAGAAAGAGGAGGG - Intergenic
1059273669 9:113082995-113083017 GGGCAGCTGGAGAAAGAGGAGGG - Intergenic
1059274805 9:113088441-113088463 GGGCAGCTGGAGAAAGAGGAGGG - Intergenic
1059490893 9:114666590-114666612 GGGCATCTCCATGAGGAAGAGGG - Intergenic
1059624246 9:116044109-116044131 GGGTAAGTGAATAAGGTGGATGG + Intergenic
1060218602 9:121752881-121752903 CCTCATCTGAAAAAGGAGGAAGG - Intronic
1060489501 9:124072112-124072134 GGGTAGATGAATAAGAAGGATGG + Intergenic
1060656143 9:125374109-125374131 GGCCATCTGAGGCAGGAGGAAGG - Intergenic
1060874274 9:127069055-127069077 GTGCATATGAAGAAGGAGGCAGG - Intronic
1061194972 9:129102598-129102620 GGGCAAGTGAATGGGGAGGAGGG + Intronic
1061551080 9:131335031-131335053 GGGCACCTGGAGAAGGAGTAGGG - Intergenic
1061641378 9:131959507-131959529 GGCCCTCTGTACAAGGAGGAGGG - Intronic
1186387876 X:9128222-9128244 GTGCATCTGAATCAGCAGAAAGG + Intronic
1188783143 X:34309944-34309966 GGGCAGATGAATAAGAAGAATGG - Intergenic
1190087765 X:47410608-47410630 GGGCCTCTGATGGAGGAGGAAGG - Intronic
1190582774 X:51904346-51904368 GGGAACCTGAAGAAGGAAGAGGG + Intergenic
1193859289 X:86644141-86644163 GGGCATCTGAATAGGAAGAGAGG + Intronic
1193952201 X:87813593-87813615 GGGTATGTGTATAAGGAGTAAGG + Intergenic
1194712273 X:97250407-97250429 GGGCAACTGAATATGCAGGTTGG + Intronic
1196436260 X:115677345-115677367 GGCCAACTGAATAAGGAAGGAGG + Intergenic
1197198496 X:123727679-123727701 GGGCAACTGAGGCAGGAGGAAGG - Intronic
1197770450 X:130086089-130086111 GGGCATTTGCTTAAGTAGGAGGG - Intronic
1197782830 X:130174007-130174029 GGGAATCTAAAGAAGGAGGGAGG + Intronic
1198339400 X:135699484-135699506 AGGAATCTGAATGAGGAGGAAGG + Intergenic
1200136162 X:153875768-153875790 GGGGATCTGGATAAGCAGGCAGG + Exonic
1200834852 Y:7723541-7723563 TGGCTTCTGAGTAAGGAGGAGGG - Intergenic