ID: 1125438963

View in Genome Browser
Species Human (GRCh38)
Location 15:39680564-39680586
Sequence GAAATGGTCAGAGCCATCTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 4, 3: 7, 4: 176}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125438960_1125438963 -4 Left 1125438960 15:39680545-39680567 CCCTAGTTAGAATCTGATTGAAA 0: 1
1: 0
2: 1
3: 13
4: 182
Right 1125438963 15:39680564-39680586 GAAATGGTCAGAGCCATCTTAGG 0: 1
1: 0
2: 4
3: 7
4: 176
1125438961_1125438963 -5 Left 1125438961 15:39680546-39680568 CCTAGTTAGAATCTGATTGAAAT 0: 1
1: 0
2: 0
3: 19
4: 208
Right 1125438963 15:39680564-39680586 GAAATGGTCAGAGCCATCTTAGG 0: 1
1: 0
2: 4
3: 7
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125438963 Original CRISPR GAAATGGTCAGAGCCATCTT AGG Intronic
903397141 1:23010519-23010541 GACATGGTCAGAGCCAGGCTTGG + Intergenic
904360193 1:29966148-29966170 GAAAGGGTCAGAGCCAGAATGGG - Intergenic
905089678 1:35419299-35419321 GAAAGGTTGAGAGCCATATTAGG + Intronic
906801133 1:48737973-48737995 CACATGGTCAGAGACATCTCTGG + Intronic
907626189 1:56032438-56032460 GAGATGGTAAGAGCCAGATTAGG + Intergenic
910392636 1:86760688-86760710 GATATTGTTACAGCCATCTTTGG + Intergenic
910667736 1:89742550-89742572 GCAATGGACAGAGCCATTTGAGG + Intronic
916290771 1:163164051-163164073 GAAATGTGCAGAGCCCGCTTGGG + Intronic
917001754 1:170368202-170368224 GAAATGGTCAGTGAGACCTTCGG - Intergenic
917195117 1:172456509-172456531 GAAATGGGCACAGGCATCTCAGG + Intronic
918048666 1:180956084-180956106 GAAATGGCAAGAGCCTTCCTTGG + Intergenic
918559275 1:185845087-185845109 GTTATGGTCAAAGCCAGCTTAGG + Intronic
918774055 1:188606305-188606327 CAAATTGTCAGAGACATTTTAGG + Intergenic
919312767 1:195932336-195932358 GAAAATTTCAGAGACATCTTTGG - Intergenic
920679885 1:208064337-208064359 GCAATGGTCAGAGCCATGGAAGG - Intronic
920727754 1:208452446-208452468 AAAGAGGTGAGAGCCATCTTTGG - Intergenic
921405079 1:214769973-214769995 GAAATGGCCACAGCCACCCTAGG + Intergenic
921760599 1:218909389-218909411 GACATGGTCCCAGCCCTCTTTGG - Intergenic
922160467 1:223075960-223075982 GACATAGTCAGAACCAGCTTTGG - Intergenic
922929924 1:229381162-229381184 CTAATTGTCAGAGCCATCCTAGG + Intergenic
1064143820 10:12811853-12811875 GAAATGGACAGACCCATCTTGGG + Intronic
1065808832 10:29421979-29422001 GAAGTGGTCAGAGTCCTCTGTGG + Intergenic
1066434628 10:35385866-35385888 GAAAAGGTCAGCATCATCTTAGG + Intronic
1068388031 10:56358360-56358382 GAAAAGGTCAGACCCAACTCAGG - Exonic
1068965037 10:62903298-62903320 GAAATGGGCGGAGACACCTTAGG - Intronic
1069066957 10:63951890-63951912 GAAATGGAGAGAGCCCTCTGGGG + Intergenic
1070584887 10:77756596-77756618 TAAATGGTCAGAGCCAAATGAGG - Intergenic
1070790945 10:79188975-79188997 GATCTGGGCAGAGCCATCTGGGG + Intronic
1071491042 10:86136593-86136615 CAAAGGGCCAGAGCCATCGTGGG + Intronic
1071600794 10:86957891-86957913 GAAGTGGTCAGGTCCATCTCAGG + Intronic
1072680696 10:97504151-97504173 GAGATGGTCAGAGTCAGGTTCGG - Intronic
1074277510 10:112018159-112018181 GCAATGGTTAGAGACATTTTAGG + Intergenic
1076366707 10:129926040-129926062 GAAATGCTGAGAGACATCTGAGG + Intronic
1078549547 11:12270733-12270755 CTAATGGCCAGAGCCATCTCTGG - Intergenic
1078999316 11:16738221-16738243 GAAATGGTAGAAGCCATTTTTGG + Intronic
1079935916 11:26615923-26615945 TGAATGCTCAAAGCCATCTTTGG + Intronic
1080235284 11:30061220-30061242 GAAAAGATTAGAGCCTTCTTCGG - Intergenic
1082811395 11:57481265-57481287 GCAATAGCCAGAGACATCTTTGG - Intergenic
1083843501 11:65317449-65317471 GAACTGGCAAGAGCCACCTTTGG + Intronic
1084414965 11:69026608-69026630 GCAATGTCCAGAGGCATCTTTGG + Intergenic
1085591884 11:77770659-77770681 GAAATAATCTGAGCCATGTTTGG - Intronic
1088533553 11:110836450-110836472 GGAATGGTCAGAGGCATCAATGG - Intergenic
1088952786 11:114587980-114588002 CAAATGGTCAGAGGTCTCTTAGG + Intronic
1089061483 11:115629594-115629616 GAAGTGGGCAGAGGCATCCTGGG - Intergenic
1090914311 11:131149647-131149669 GCAAAGGTCAGAGTCAACTTGGG - Intergenic
1090930243 11:131291063-131291085 GAAATGATCAGAGACATAATGGG - Intergenic
1093715213 12:22374243-22374265 GCAATGTCCAGAGACATCTTTGG + Intronic
1094157501 12:27352417-27352439 AAAATAGTAAGAGCCATCTATGG + Intronic
1097059307 12:56270525-56270547 GAAAGGGTCAGGCCCATCGTAGG + Exonic
1097293563 12:57941073-57941095 AATATGGCCAGAGGCATCTTTGG + Intergenic
1101916406 12:108899516-108899538 GAAAATGCCAGAGCCATCTGAGG - Intronic
1102123097 12:110458453-110458475 TAAATGGTCAAAGCCAGGTTAGG + Intronic
1106576571 13:30980418-30980440 GGAAGGGACAGAGCCATTTTGGG + Intergenic
1107279183 13:38713924-38713946 GAGATGTTCAGAGGCATCTCTGG - Intronic
1107324311 13:39224605-39224627 AAAATGGTCACTGCCATCTTGGG - Intergenic
1108024013 13:46159870-46159892 AAATTGTTGAGAGCCATCTTTGG - Intronic
1110607871 13:77454157-77454179 GAAATGGTTAGATCCATTTATGG + Intergenic
1110740040 13:78984242-78984264 GAAATGGTGTGAGCCACTTTGGG + Intergenic
1111377258 13:87396801-87396823 GAGATGTTCAAAGCCATCTTGGG + Intergenic
1114032823 14:18590715-18590737 CAAATGGCCAGAGGCATCTGGGG - Intergenic
1114077611 14:19169762-19169784 CAAATGGCCAGAGGCATCTGGGG - Intergenic
1114084553 14:19229821-19229843 CAAATGGCCAGAGGCATCTGGGG + Intergenic
1117679861 14:58192890-58192912 GAAAAGGACAGAGGCAGCTTAGG + Intronic
1118316456 14:64729041-64729063 GAACAGGTCAGCGCCCTCTTTGG + Intronic
1118391855 14:65302548-65302570 GAAGTGGTCAAAGCCAACATGGG - Intergenic
1120530013 14:85621060-85621082 GAAAGGCTCAGAGTCATATTGGG + Intronic
1121797451 14:96746829-96746851 GCCATGGACAGAACCATCTTCGG - Intergenic
1202896150 14_GL000194v1_random:11653-11675 TAAATGGCCAGAGGCATCTGGGG + Intergenic
1125438963 15:39680564-39680586 GAAATGGTCAGAGCCATCTTAGG + Intronic
1127190226 15:56522257-56522279 AAAATAGTAAGAGCCATCTATGG + Intergenic
1127661062 15:61100592-61100614 GAAATCTTCAGAGCCACCTGTGG + Intronic
1127990626 15:64113356-64113378 GAAATGGTTGGAGACATTTTTGG + Intronic
1130907293 15:88249637-88249659 GAAATGGGAAGAGCCTCCTTGGG + Intronic
1131021984 15:89106649-89106671 AAATTAGTCAGAGCCATCATAGG - Intronic
1131347039 15:91659659-91659681 GAAATGGAAGGAACCATCTTGGG + Intergenic
1140298786 16:73736138-73736160 GAAATGGTCAGAGACAGATGGGG + Intergenic
1140306946 16:73811869-73811891 GAGATGGTCAGAGCCAAGTGAGG - Intergenic
1140672147 16:77289825-77289847 GAAATGGTCAGAGACAGCTCTGG + Intronic
1144868536 17:18353355-18353377 GAAAAGGTCAGTGTCATCTGAGG - Intronic
1150971151 17:70029640-70029662 GCAAAGGTCAGAGCCAGCTGGGG + Intergenic
1151084040 17:71360631-71360653 GAAATGGAAGGAGCCATCTAAGG - Intergenic
1151155240 17:72119773-72119795 GAAATGCTTAGAGCCAGGTTGGG - Intergenic
1151738497 17:75962074-75962096 GAAATGATCAGAGCTATGTGAGG - Intronic
1155802466 18:30125779-30125801 GAATTGCTCAGAGTCATTTTTGG - Intergenic
1158389216 18:57030384-57030406 GGAGTGGTCTGAGGCATCTTGGG + Exonic
1159289722 18:66400767-66400789 GAAATGGTCAGTGGTGTCTTTGG - Intergenic
1167348353 19:48960831-48960853 GAACTGATCAGAACCATCATGGG + Exonic
1167494600 19:49810191-49810213 GAAAGGGGCAGAGCCAGCTCTGG + Intronic
1167673011 19:50866464-50866486 GAAATTGTAAGAGCCAGATTCGG + Intronic
931206665 2:60153151-60153173 AAAATGTTGAGAGCCATTTTTGG + Intergenic
931919574 2:66999034-66999056 TAAATAGTAAGAGCCATCTATGG - Intergenic
931960116 2:67473104-67473126 GAAAGGGGCAGAGCCAACTAGGG + Intergenic
932320407 2:70818072-70818094 GAAAGGGTCCCTGCCATCTTGGG - Intronic
933731128 2:85457000-85457022 GAAGTGGTCAGAGCCCTCTTTGG - Intergenic
938492035 2:131766289-131766311 CAAATGGCCAGAGGCATCTGGGG - Intronic
938495532 2:131796054-131796076 CAAATGGCCAGAGGCATCTGGGG + Intronic
939083938 2:137694909-137694931 GAAATGGCCACAAGCATCTTGGG - Intergenic
941085530 2:161113002-161113024 GAAATGATAATAGCCCTCTTTGG - Intergenic
941889741 2:170567435-170567457 GAAATGTTTAAAGCCCTCTTTGG + Intronic
943331913 2:186570058-186570080 TAAATGGCCACAGCCATCCTTGG + Intergenic
943618003 2:190115791-190115813 GAAATGGTCAGAGGCCTAATGGG + Intronic
944888700 2:204093304-204093326 GAAAAAGTCAAAGCAATCTTTGG - Intergenic
947575236 2:231268371-231268393 GTAATGGTAATAGGCATCTTGGG + Intronic
1175179549 20:57135851-57135873 GGAATGAACAAAGCCATCTTAGG + Intergenic
1176615830 21:9027636-9027658 TAAATGGCCAGAGGCATCTGGGG + Intergenic
1176709330 21:10136098-10136120 CAAATGGCCAGAGGCATCTGGGG - Intergenic
1177008486 21:15702872-15702894 GAGATGGCCTGTGCCATCTTGGG + Intergenic
1178106677 21:29327086-29327108 GATCTGTTCTGAGCCATCTTTGG - Exonic
1180293417 22:10863380-10863402 CAAATGGCCAGAGGCATCTGGGG - Intergenic
1180456938 22:15517771-15517793 CAAATGGCCAGAGGCATCTGGGG - Intergenic
1180496223 22:15892796-15892818 CAAATGGCCAGAGGCATCTGGGG - Intergenic
1180669242 22:17540556-17540578 GAAGTGGTGGGAGCCATGTTTGG + Exonic
1183024554 22:35054594-35054616 GAAATGCTGAGAGACACCTTGGG - Intergenic
1183757120 22:39778662-39778684 GAAATGGTATTTGCCATCTTAGG - Intronic
949332233 3:2935190-2935212 CAAAGGGTCAGACCCATCTCAGG - Intronic
954196649 3:49001143-49001165 GATATGGGCTGACCCATCTTTGG - Intronic
956750724 3:72342042-72342064 GAAAGGGTCAGAGCCATCTGGGG + Intergenic
960467407 3:118014239-118014261 GAAATGGTCAGAGCCATGTGAGG + Intergenic
960848935 3:122031636-122031658 GAAATGGTCAGAGAGTTTTTTGG - Intergenic
961573439 3:127816673-127816695 GCAATGGGCAGTGCCATCCTCGG - Intronic
962166973 3:133059417-133059439 GAAATGGACAAATCAATCTTAGG - Intronic
962305344 3:134281226-134281248 GAATTGGCAACAGCCATCTTTGG + Intergenic
964168184 3:153734540-153734562 GAAAAGGCCAGACCTATCTTTGG + Intergenic
967213660 3:187191789-187191811 GAATTGGTGGCAGCCATCTTTGG - Intergenic
967857527 3:194129626-194129648 GAAAGGGTCAGAGCCATGCTGGG - Intergenic
968729910 4:2264768-2264790 AAGATGGGCAGAGGCATCTTGGG + Intergenic
969458080 4:7312429-7312451 GAAATGGGCAGAGGCATCAGAGG - Intronic
970668800 4:18371863-18371885 AAAATGATAAGAGCCATCTATGG + Intergenic
972663496 4:41141591-41141613 TAAAGGGTCACAACCATCTTTGG - Intronic
972922061 4:43956147-43956169 GGAATGGTCAGGGACATTTTTGG + Intergenic
975058533 4:69967217-69967239 GAAATGGTCCTGGGCATCTTAGG + Intergenic
975599309 4:76082795-76082817 GCAATGGTCAGAAACATTTTTGG + Intronic
977139215 4:93346099-93346121 CAAATAGTCAAAGCAATCTTTGG - Intronic
978417208 4:108489103-108489125 GAAATGGTCTGACCCTGCTTTGG - Intergenic
979214110 4:118141614-118141636 GATATATACAGAGCCATCTTTGG - Intronic
979485698 4:121267495-121267517 GAAATGGTCATAACAATTTTTGG + Intergenic
982125883 4:152183415-152183437 GGAATGGACTGAGACATCTTCGG - Intergenic
982237468 4:153265217-153265239 GAAATAATCAGAGCCATGCTGGG - Intronic
982456442 4:155615099-155615121 GAAATCCTCAAAACCATCTTTGG - Intergenic
985246594 4:187985197-187985219 GAAATGTACAGAGCCATGTGAGG + Intergenic
988536077 5:32070373-32070395 GAAGTGGACATAGCCATCATAGG + Intronic
992295177 5:75320472-75320494 GAAATTTTCAGAGCCTTCTGGGG - Intergenic
993796254 5:92271420-92271442 GAAATAATAAGAGCCATCTATGG + Intergenic
996648620 5:125846119-125846141 GCAATGGCCAGAGCTTTCTTTGG - Intergenic
1000799155 5:165702994-165703016 GAAATGTTCACAGCAATTTTAGG - Intergenic
1003113794 6:3270083-3270105 GAAATGTTCAGCTCCATCTCAGG + Exonic
1004842477 6:19603074-19603096 GTTATTGTCAAAGCCATCTTTGG + Intergenic
1005408663 6:25519324-25519346 GAAATGGACAGATGCATTTTGGG + Intronic
1006645978 6:35514330-35514352 TATATGGTCAGAGCCAACTGAGG - Intergenic
1006722630 6:36167883-36167905 GAAATGGTGAAAGACATTTTAGG + Intergenic
1007312831 6:40960428-40960450 GCAAGTGTCGGAGCCATCTTAGG - Intergenic
1007365591 6:41389941-41389963 GATATTGTGACAGCCATCTTTGG - Intergenic
1009959754 6:70504483-70504505 GACATGGACATAGCCATTTTTGG + Intronic
1011661533 6:89598881-89598903 GAAAAGGTCAGATGCATCTGTGG - Intronic
1012822019 6:104097145-104097167 GAAATAATCAGAGATATCTTGGG + Intergenic
1012857875 6:104524674-104524696 GAAATAATCAGAGCTATCTAAGG + Intergenic
1013549007 6:111189226-111189248 GAGATGGTAAGAGACAACTTTGG + Intronic
1018360853 6:163066274-163066296 GAAATGGGGAGAAACATCTTGGG + Intronic
1018419272 6:163628076-163628098 GAAATGAACAGCGCCTTCTTAGG + Intergenic
1019411064 7:906973-906995 GACATGGCCAGAGCCACCATGGG + Intronic
1028482054 7:91317694-91317716 GGAATTGTCAGGGCCAACTTTGG + Intergenic
1029147581 7:98457847-98457869 GGAATGATCAGAGCCACCTTGGG + Intergenic
1031150516 7:118048784-118048806 GAATTGATCATAGCTATCTTTGG - Intergenic
1035252840 7:157608414-157608436 GAAATGCTTGGAGCCATCCTGGG + Intronic
1035781631 8:2232638-2232660 GAAGGGGTCGGGGCCATCTTGGG + Intergenic
1041723539 8:60997888-60997910 AAAAAGGTCATAGCCCTCTTGGG + Intergenic
1047462925 8:125086009-125086031 GAATTGTTGGGAGCCATCTTTGG - Intronic
1048327995 8:133453360-133453382 GAAATTGTCAGGGCCCTCCTTGG - Intergenic
1049786537 8:144453638-144453660 GAAACAGGCAGAGCCAGCTTGGG + Intronic
1050514869 9:6432821-6432843 AAAATGGCCAGAGCCCTTTTAGG - Intronic
1051533923 9:18135767-18135789 GCAATCCTCAGAGGCATCTTAGG - Intergenic
1051732092 9:20154856-20154878 GGAATGGCTACAGCCATCTTGGG - Intergenic
1053646299 9:40121634-40121656 CAAATGGCCAGAGACATCTGGGG - Intergenic
1053759415 9:41341917-41341939 CAAATGGCCAGAGACATCTGGGG + Intergenic
1054538269 9:66254339-66254361 CAAATGGCCAGAGACATCTGGGG + Intergenic
1055858159 9:80717132-80717154 AAAGTGGGCAGAGCCATATTGGG - Intergenic
1056260763 9:84846015-84846037 GAAATTATAAGAGCCATTTTTGG - Intronic
1058777815 9:108302485-108302507 GAAATGATCAGGGCCATCCTAGG - Intergenic
1060242999 9:121920771-121920793 GAAATGATCATGGCCATATTTGG - Intronic
1062010832 9:134265797-134265819 GGAATGGTCAGAGCTCCCTTTGG - Intergenic
1186817952 X:13256460-13256482 GCAATGTTTAGAGACATCTTTGG + Intergenic
1189233009 X:39466592-39466614 GATATTATCAGAGCCATCTTTGG - Intergenic
1189434102 X:40975771-40975793 GAAAAGGTCTCAGCCATGTTAGG + Intergenic
1189492564 X:41481565-41481587 GAAAGGGTCTAAACCATCTTTGG - Intergenic
1192940318 X:75904601-75904623 GAAGTGGTCTGCACCATCTTGGG - Intergenic
1194845645 X:98804606-98804628 TTAATGGTCATAGCCTTCTTGGG + Intergenic
1200126411 X:153816882-153816904 GATGTGGTCAGAGTCAGCTTGGG + Intronic
1201149224 Y:11086360-11086382 TAAATGGCCAGAGGCATCTGGGG + Intergenic