ID: 1125442063

View in Genome Browser
Species Human (GRCh38)
Location 15:39713821-39713843
Sequence CAGTGAAAACAGCTGGAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 493
Summary {0: 1, 1: 0, 2: 5, 3: 41, 4: 446}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125442060_1125442063 12 Left 1125442060 15:39713786-39713808 CCAACTTCTGTAATCATTTGGGA 0: 1
1: 0
2: 0
3: 21
4: 177
Right 1125442063 15:39713821-39713843 CAGTGAAAACAGCTGGAGCCAGG 0: 1
1: 0
2: 5
3: 41
4: 446
1125442058_1125442063 13 Left 1125442058 15:39713785-39713807 CCCAACTTCTGTAATCATTTGGG 0: 1
1: 0
2: 1
3: 18
4: 178
Right 1125442063 15:39713821-39713843 CAGTGAAAACAGCTGGAGCCAGG 0: 1
1: 0
2: 5
3: 41
4: 446

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125442063 Original CRISPR CAGTGAAAACAGCTGGAGCC AGG Intronic
900125163 1:1065637-1065659 AAGAGAAAACAGCTGGGCCCCGG + Intergenic
900414104 1:2527272-2527294 CCTTGGAAGCAGCTGGAGCCAGG + Intergenic
902456422 1:16536681-16536703 CAGTGGGACCAGCAGGAGCCTGG - Intergenic
902495741 1:16871230-16871252 CAGTGGGACCAGCAGGAGCCTGG + Intronic
902724491 1:18325746-18325768 CTGGGAAAACAGATGGAGACAGG - Intronic
902788805 1:18751108-18751130 CAGTGTAAACAGCTGCAGTGAGG + Intergenic
905910038 1:41647431-41647453 CTGTGGAAACAGCTTGTGCCCGG - Intronic
906086508 1:43139627-43139649 AAGAGAAAACAGCTGGGCCCGGG - Intergenic
906096275 1:43226311-43226333 GACTCAAAACAGCTGGAGGCTGG + Intronic
907629848 1:56069526-56069548 CAGTGGAAAGAGCAGGAGCAAGG + Intergenic
909219877 1:72943835-72943857 CAGTGAAAACTGCTGGAATATGG - Intergenic
909405325 1:75282080-75282102 CAGTGACAACAGCTGGAAAGGGG + Intronic
910942339 1:92550294-92550316 CAATGAGAACAGCTGGACACGGG + Intronic
911139574 1:94484583-94484605 CAATGAGAACACCTGGACCCAGG + Intronic
911516656 1:98875824-98875846 CAATGAGAACACCTGGACCCAGG - Intergenic
912394315 1:109328947-109328969 CAGGTGAAACACCTGGAGCCCGG - Intronic
914071656 1:144297231-144297253 CAGGGAGAACAGCTTGAACCAGG - Intergenic
914107499 1:144669125-144669147 CAGGGAGAACAGCTTGAACCAGG + Intergenic
914505818 1:148288147-148288169 GAGTGAGACCAGCAGGAGCCTGG + Intergenic
915341598 1:155179535-155179557 AAGGGAAAGCAGCGGGAGCCGGG - Intronic
915399879 1:155614306-155614328 CAATAAAAACAGCTGGATGCAGG + Exonic
915417037 1:155750170-155750192 CAATAAAAACAGCTGGATGCAGG + Exonic
915477674 1:156162601-156162623 CAGTGTAACCAGCTCTAGCCTGG - Intronic
915491928 1:156254995-156255017 CAGGGAAAACTGCTTGAACCTGG + Intronic
915543302 1:156582264-156582286 CAGCGGGAACAGCTGGAGCTGGG - Exonic
916252396 1:162751943-162751965 CAGTGAGAACACCTGGACACAGG + Intronic
916525633 1:165606518-165606540 AAGAGAAAACAGCTGGGCCCGGG + Intergenic
917809339 1:178642338-178642360 CAGTGGAAACAGCAAGACCCCGG - Intergenic
919002662 1:191853438-191853460 CAATGAAAACACCTGGACACAGG - Intergenic
919717477 1:200794396-200794418 CACAGAAAACAGCTGGTTCCAGG - Intronic
920004889 1:202825890-202825912 CAGTGAAGACAGCTCCAGGCGGG - Exonic
921186818 1:212677660-212677682 CAGTGCAGAGAGCTGGAGACAGG + Intergenic
922212684 1:223497779-223497801 CAGTGCAAAAAGCTGGAGCCAGG + Intergenic
923786269 1:237071821-237071843 CAGGGAGAAAGGCTGGAGCCGGG - Intronic
923902180 1:238338111-238338133 CAATGAACACAGCTGGTGCCTGG - Intergenic
1063320416 10:5046781-5046803 AAGAGAAAACAGCTGGGCCCAGG + Intronic
1063344390 10:5297762-5297784 CAGTGAAAGCAGCTGGGGTCAGG - Intergenic
1067153671 10:43756910-43756932 CAATGAAAACACTTGGACCCAGG - Intergenic
1067198666 10:44146297-44146319 CAGTGAGAACACCTGGACACAGG - Intergenic
1067480424 10:46593239-46593261 CAGTAAAAGCAGCTAGAGGCAGG - Intronic
1067832261 10:49616972-49616994 TAGTGATAGCAGCTGGAGCTGGG - Intronic
1068429264 10:56911227-56911249 AAGAGAAAACAGCTGGGCCCGGG + Intergenic
1069127481 10:64654326-64654348 CAGTGAAAACACATGGACACAGG - Intergenic
1069162120 10:65105677-65105699 CAGTGAGAACACCTGGACACAGG + Intergenic
1069630328 10:69893678-69893700 CAGTGGAAACAGCTGGACCTTGG + Intronic
1069766063 10:70861428-70861450 AATTGAAAATTGCTGGAGCCTGG + Intronic
1070586345 10:77769735-77769757 AAGTGGAAAGAGCAGGAGCCAGG - Intergenic
1070617622 10:77981172-77981194 GAGTGAAGAGAGCTGGAGCTTGG - Intronic
1072068633 10:91894805-91894827 AAGAGAAAACAGCTGGGCCCCGG - Intergenic
1072819059 10:98538193-98538215 AAGAGAAAACAGCTGGGCCCGGG - Intronic
1072826247 10:98609781-98609803 CATAGGAAACAGCAGGAGCCTGG - Intronic
1072871878 10:99128628-99128650 CAGTGAGAACACCTGGAACAGGG + Intronic
1073140329 10:101242946-101242968 AAGAGAAAACAGCAGGAGCCAGG + Intergenic
1073628036 10:105119546-105119568 CTGTGAAAACAGTTGGAACGGGG + Intronic
1074324194 10:112431867-112431889 CACTGAAAACAGATGGAGCTAGG - Intronic
1074512018 10:114122105-114122127 TAATGAAAATAGCTGGGGCCGGG - Exonic
1074989295 10:118688497-118688519 ACGTGAAAACAACTGGAGGCAGG + Intronic
1075367029 10:121900675-121900697 CAATGAAAACAGCTGGAAACTGG + Intronic
1076742322 10:132492735-132492757 CAGTGGGAACAGCTGGAGCCAGG - Intergenic
1077001413 11:324915-324937 AAGAGAAAACAGCTGGGCCCAGG + Intronic
1077474645 11:2780555-2780577 CTGAGAAAACAGTTGGAGGCTGG - Intronic
1077899242 11:6476409-6476431 AAGTCAAAAGAGCTGGGGCCAGG - Exonic
1077917690 11:6621995-6622017 CAGCAAACACAGCTGCAGCCCGG - Exonic
1078278740 11:9877590-9877612 CAGTGAAAACACTTGGACACAGG - Intronic
1078305364 11:10179141-10179163 CAATGAGAACAGCTGGACACAGG + Intronic
1078404782 11:11060924-11060946 CAGTGAAAACACATGGACACGGG + Intergenic
1078741691 11:14072610-14072632 AAGTGATGACAGCTGAAGCCAGG + Intronic
1081022685 11:37967617-37967639 CACTGAAAACTACTAGAGCCGGG + Intergenic
1081306434 11:41517607-41517629 CAATGAAAAGAACTGGAGCGGGG - Intergenic
1081516325 11:43833939-43833961 CATTGTGTACAGCTGGAGCCAGG + Intronic
1081705882 11:45181593-45181615 CAACAAAAACAGCTGTAGCCCGG - Intronic
1081717220 11:45259004-45259026 AAGTGAAAACATCTGGAGGCTGG - Intronic
1083608458 11:63993067-63993089 CAGTAAAATCTGCTGGAGGCGGG + Intronic
1083863776 11:65442336-65442358 CAGTGAAAACAGCCCTAACCAGG + Intergenic
1083880025 11:65543788-65543810 CAGTGAAAGCGGCTGGGGCAGGG - Intronic
1084088013 11:66863594-66863616 CTCTGAAAACAGCTGGAGTCTGG + Intronic
1084638565 11:70410258-70410280 CAGTGATGACACCTAGAGCCAGG - Intronic
1086528679 11:87758597-87758619 CAGTGAAAACACTTGGACACAGG - Intergenic
1086557323 11:88126498-88126520 CAGTGAAAACACTTGGACCCAGG + Intronic
1087089514 11:94253997-94254019 CAGTGAAAACACTTGGACACAGG + Intergenic
1087481085 11:98701164-98701186 CAGTGAAAACACATGGACACAGG + Intergenic
1088186624 11:107177653-107177675 CAGGGAACAAAGCTGGGGCCTGG - Intergenic
1089579889 11:119475036-119475058 AGGTAAAAACAGCTGGAGGCAGG - Intergenic
1089638637 11:119832638-119832660 CATTGAAAGCATCTGGACCCAGG + Intergenic
1089784834 11:120900578-120900600 GAGGAAAAAGAGCTGGAGCCGGG + Intronic
1090678110 11:129024044-129024066 TCCTGAAAACAGCTGGAACCCGG - Intronic
1091682199 12:2535092-2535114 CAATTAAAGCAGCTAGAGCCGGG + Intronic
1091808310 12:3373627-3373649 CAGTGACAACAGCTTTAGCCTGG + Intergenic
1091867807 12:3857074-3857096 CAATGAAAACACCTGGACACAGG + Intronic
1093083952 12:14845733-14845755 CAGTGAAAACAACTGGGGTAGGG + Intronic
1093925511 12:24904497-24904519 CAGTTAATACAGATGGAGGCCGG - Intronic
1094672703 12:32586599-32586621 AAGGGAAAACAGATGGAGCAGGG + Intronic
1095104952 12:38222087-38222109 GAGTGATAACAGATGGATCCGGG + Intergenic
1096239987 12:49954668-49954690 CAGTGACGACAGCTGGAGCCAGG - Exonic
1096330145 12:50704667-50704689 GAGTGAAAACAGTTTGGGCCGGG + Intronic
1096569140 12:52509903-52509925 CAGTGAGAACACATGGAGACAGG - Intergenic
1096893874 12:54800272-54800294 CAGTGAGAACACCTGGACACAGG + Intergenic
1097122959 12:56750073-56750095 CAGTGGAAACAGCTTGAGCAAGG + Intronic
1097706134 12:62870275-62870297 TAGTGAAAAGGGATGGAGCCAGG + Intronic
1097772419 12:63603565-63603587 CAGTGAGAACACATGGACCCAGG - Intronic
1098484703 12:71007051-71007073 CAGGGAAAACAGCAGGCACCAGG + Intergenic
1098527406 12:71501599-71501621 CAATAAAAACAGCTGTGGCCTGG - Intronic
1098529126 12:71520664-71520686 CAGTGAGAACAGATGGACACAGG + Intronic
1098625380 12:72659932-72659954 AAGAGAAAACAGCTGGGCCCCGG + Intronic
1098667247 12:73179889-73179911 TAGTGAATACAGGTGGAGCCAGG - Intergenic
1099052192 12:77793517-77793539 CAGTGAAAACACATGGACACAGG - Intergenic
1099165378 12:79300241-79300263 CAGAGAAAAATGCTGGTGCCAGG - Intronic
1099838709 12:87939200-87939222 CAGTGATGACAGCTGTAGCCTGG - Intergenic
1100211551 12:92403905-92403927 AAGTGAAAAGAGCTTGAGGCAGG + Intergenic
1101498823 12:105281844-105281866 AAGGGAAAACAGAAGGAGCCTGG + Intronic
1101861653 12:108487057-108487079 CAATGAGAACAGCTGGACACAGG - Intergenic
1102248475 12:111369600-111369622 CAGAAAAAACAGCTGAATCCAGG + Intergenic
1102797560 12:115702071-115702093 CAATGAAAACACTTGGAACCAGG + Intergenic
1104589484 12:130072889-130072911 CAGTGTAGACAGCTGGGCCCTGG - Intergenic
1104957152 12:132472529-132472551 TAGGGAGAGCAGCTGGAGCCGGG + Intergenic
1105855544 13:24368771-24368793 AAGAGAAAACAGCTGGGCCCGGG + Intergenic
1106715949 13:32387996-32388018 AAGAGAAAACAGCTGGACCCAGG - Intronic
1107962189 13:45568322-45568344 AAGTGAAAACAGATGGAAACTGG - Exonic
1108917721 13:55636374-55636396 CAGTGAGAACAGATGGACACAGG + Intergenic
1110337819 13:74352503-74352525 CAGTGAGAACAGATGGACACAGG + Intergenic
1110851851 13:80255086-80255108 CAGTGAGAACACCTGGACACAGG + Intergenic
1111215209 13:85132692-85132714 AAGAGAAAACAGCTGGGCCCGGG + Intergenic
1111367717 13:87271345-87271367 CAATGAGAACAGCTGGACACAGG + Intergenic
1111942339 13:94624015-94624037 CAGCATAAGCAGCTGGAGCCAGG + Intronic
1113059729 13:106309389-106309411 CAGTGAGAACACCTGGACACAGG + Intergenic
1113782347 13:112983841-112983863 CAAGGAAAACAGCTGCAGCACGG - Intronic
1114149592 14:20022427-20022449 CAGTCACAACAGTAGGAGCCTGG + Intergenic
1114874005 14:26692957-26692979 CAGAGAAAACAGCTCTGGCCTGG + Intergenic
1115085741 14:29512993-29513015 CTGTGAAAGCAGCTGGAGGGAGG - Intergenic
1115882494 14:37935338-37935360 CAGTGAAAACACATGGACACAGG - Intronic
1117931861 14:60851745-60851767 CAGTGAAAACACATGGACACAGG - Intronic
1118005099 14:61558431-61558453 CAGTGAAAGCAGCAGGGGCCTGG - Intronic
1118407582 14:65441991-65442013 CAATGAGAACAACTGGACCCAGG - Intronic
1118466934 14:66039495-66039517 CAGAGGAAACAACTGGAGCTTGG - Intergenic
1119415125 14:74464812-74464834 CAGTGAAAACATCTTGAGAAAGG + Intergenic
1121382339 14:93483733-93483755 CACTGAGAACACCTGGACCCAGG - Intronic
1121540243 14:94720374-94720396 CCTTGAAAACACCTGGAGGCCGG + Intergenic
1121728171 14:96167936-96167958 CAGAGAAAACAGCATGAGACAGG - Intergenic
1123875644 15:24621524-24621546 CAGAGAACAAAGCTGGAGGCTGG - Intergenic
1124798361 15:32804704-32804726 CAGTGAGAACAGATGGACACAGG - Intronic
1125069893 15:35541583-35541605 CAGTGCAAAAACATGGAGCCTGG + Intronic
1125442063 15:39713821-39713843 CAGTGAAAACAGCTGGAGCCAGG + Intronic
1125785746 15:42316280-42316302 AAGAGAAAACAGCTGGGCCCAGG + Intronic
1126398252 15:48242320-48242342 CAGGGAAAACAGCTCCAGGCTGG + Intronic
1126963596 15:54026565-54026587 CAGCAAAATCAGCTGGAGACTGG - Intronic
1127283154 15:57509304-57509326 GAGTGAAAACAGCTGAGGCGTGG - Intronic
1127920923 15:63493537-63493559 CAGAGGAAACAGCTCGAGCCAGG + Intergenic
1128240113 15:66095994-66096016 CAGTGAGAACAGGGGGAGCCCGG - Intronic
1128775689 15:70318419-70318441 CAGTGCAACCAGCTGGTTCCTGG - Intergenic
1129194619 15:73956518-73956540 CCCTGAAGAGAGCTGGAGCCTGG + Intergenic
1129468135 15:75735474-75735496 AAGGGAAAACAGCTGGGCCCAGG - Intergenic
1129908270 15:79205210-79205232 CCCTGAACACAGCTGGGGCCAGG + Intergenic
1130333564 15:82940014-82940036 CAATGAGAACACCTGGAGACAGG + Intronic
1131374817 15:91914865-91914887 AAGAGAAAATAGCTGGGGCCGGG - Intronic
1131522483 15:93126900-93126922 CAGTGGACACAGCTGGAGCAGGG + Intergenic
1131905689 15:97139526-97139548 CAGTGTAAACAGCAGGGGCCAGG - Intergenic
1132234213 15:100206938-100206960 CTGTGATGACAGCCGGAGCCAGG + Intronic
1132272431 15:100538178-100538200 CTGTGAAAACAGCTGGGAGCAGG - Intronic
1132932308 16:2464890-2464912 GAGAGAAAACAGAGGGAGCCAGG - Exonic
1133335363 16:5003569-5003591 CACTGGTAAGAGCTGGAGCCTGG + Exonic
1133633221 16:7641726-7641748 TAGTGAAAAGAGCTGGATTCAGG + Intronic
1134121587 16:11587753-11587775 CAGTGATAACAGCAGCAGCCTGG + Intronic
1135054929 16:19223674-19223696 CTGTGAAAGCAGCTGTAGTCAGG + Intronic
1135148677 16:19986246-19986268 AAGGGCCAACAGCTGGAGCCTGG - Intergenic
1135201346 16:20440187-20440209 GAAGCAAAACAGCTGGAGCCTGG - Intronic
1135217763 16:20587677-20587699 GAAGCAAAACAGCTGGAGCCTGG + Intergenic
1136473096 16:30494839-30494861 CAGAGAAGACAGGTGGGGCCAGG + Exonic
1137907594 16:52339327-52339349 CAGTGAAAACACTTGGACACAGG + Intergenic
1137972491 16:53000105-53000127 CAGTGAAAACACTTGGACACAGG + Intergenic
1138188549 16:54995867-54995889 CAGTGAAAACAGGCTGAGCTGGG - Intergenic
1138357746 16:56397475-56397497 CAATGAGAACAGCTGGACACAGG + Intronic
1138376882 16:56570307-56570329 CAGTGGAAACAGCTTGGCCCTGG + Intergenic
1139740968 16:69034500-69034522 CTGTAACCACAGCTGGAGCCTGG - Intronic
1140420839 16:74817518-74817540 CAGAGAAAGCAGCAGCAGCCAGG - Intergenic
1140437898 16:74963536-74963558 CAGTGAAAACACATGGACACAGG + Intronic
1142045982 16:87925573-87925595 CAGTGACACCAGCTGGTGCTGGG + Intronic
1142393767 16:89819480-89819502 AAGAGAAAACAGCTGGGCCCCGG - Intronic
1142843530 17:2653217-2653239 CAATGAGAACAGCTGGACACAGG + Intronic
1143376868 17:6472172-6472194 CAGGGAGAACAGCAGGAGCGAGG - Intronic
1143469526 17:7163481-7163503 CCTTGAAAATAGCTGGATCCTGG + Intergenic
1144254969 17:13458617-13458639 CAGTGAAAGGAACTGGAGTCAGG + Intergenic
1144632025 17:16878710-16878732 CAGTGGCCACAGCTGCAGCCTGG + Intergenic
1147836336 17:43334773-43334795 AAGAGAAAACAGCTGGGCCCAGG + Intergenic
1147991600 17:44337271-44337293 AAGAGAAAACAGCTGGACCCTGG + Intergenic
1148236338 17:45971729-45971751 CTGTGGAAACAGCTGGAACACGG - Intronic
1149516991 17:57288286-57288308 CAGCGACAACAGCTGGGTCCAGG - Intronic
1151886824 17:76927534-76927556 CATTAAAAACAGCTGAAACCCGG - Intronic
1152025226 17:77804670-77804692 CAGGGAAAACTGTGGGAGCCTGG - Intergenic
1152883595 17:82834664-82834686 CAGTGAAAACACATGGACACAGG + Intronic
1155731797 18:29168834-29168856 CAGTGAAACCATCAGGATCCAGG + Intergenic
1158368284 18:56766616-56766638 CAGGGAAAATTGCTGCAGCCTGG - Intronic
1158426854 18:57348018-57348040 ATGTCAAAGCAGCTGGAGCCAGG - Intergenic
1158953052 18:62514464-62514486 CAGTGAAAACAACTGGACCTGGG - Intergenic
1160044863 18:75377081-75377103 AAGTCACAACAGCTGGAGGCTGG - Intergenic
1161058310 19:2201413-2201435 CAGGGAAGACAGCAGGAGCGAGG - Intronic
1161330190 19:3683233-3683255 CAGTGCAGACAGCACGAGCCTGG + Intronic
1161914621 19:7219291-7219313 CAGTGAAAGTAACTGGAGCCCGG - Intronic
1162834397 19:13306804-13306826 CAGAGTAAACAGCTCGAGACTGG - Intronic
1163235876 19:16030194-16030216 AAGAGAAAACAGCTGGGCCCAGG + Intergenic
1163328428 19:16620187-16620209 CAGCATAAACAGCTGGACCCAGG + Intronic
1163386931 19:17005532-17005554 CAGTGAAAACAGCTGCGGACGGG - Intronic
1164721788 19:30437915-30437937 CAGTGAGAACAGCTTGCCCCTGG - Intronic
1164967388 19:32497171-32497193 AAGAGAAAACAGCTGGGTCCAGG + Intergenic
1165472097 19:36009703-36009725 GAGTGAAAATTGCTGGGGCCTGG + Intronic
1165852727 19:38859606-38859628 AAGAGAAAACAGCTGGGCCCGGG + Intergenic
1166514694 19:43437645-43437667 AAGAGAAAACAGCTGGGCCCAGG - Intergenic
1166717491 19:44977707-44977729 CAGAAAAAGCAGCTGGAGACAGG + Intronic
1166834909 19:45661386-45661408 GAGTGAAAATTGCTTGAGCCCGG - Intergenic
1167314064 19:48753615-48753637 AAGAGAAAACAGCTGGGCCCGGG + Intronic
1167927688 19:52834823-52834845 AAGAGAAAACAGCTGGGCCCGGG + Intronic
1168028061 19:53658019-53658041 CAGGGGAAAGGGCTGGAGCCAGG - Intergenic
1168296528 19:55379728-55379750 CAGTGAAGACAGAAGGAGGCCGG + Intronic
925043623 2:753400-753422 CAGTGAGGCCAGCTGTAGCCAGG + Intergenic
925893400 2:8454005-8454027 AAGTGAGAACAGGTGCAGCCTGG + Intergenic
926451150 2:13005847-13005869 CAGTGCAAAGAACTGGAGACAGG - Intergenic
926785369 2:16512589-16512611 CAATGGCAACAGCTGCAGCCAGG - Intergenic
927451100 2:23210126-23210148 CATGGAAAACAGTGGGAGCCAGG - Intergenic
927464746 2:23328747-23328769 CAGTGAAACCAGAGGGAGGCAGG - Intergenic
927537217 2:23872960-23872982 CAGTGAGAGCACCTGGAACCTGG - Intronic
928495586 2:31828657-31828679 CTGTGGACACACCTGGAGCCTGG - Intergenic
928650817 2:33401722-33401744 AAGTGGAAACAGCTGGAAACTGG - Intergenic
929050017 2:37828487-37828509 CAGTGGGGACAGCTGAAGCCGGG + Intergenic
929158603 2:38810289-38810311 CAGGGAACAAAGCTGGGGCCCGG + Intronic
929611914 2:43277055-43277077 CAGGGAAATCAGCTGGGGGCTGG - Intronic
929640376 2:43572287-43572309 TAGTAAAACCAGCTGGTGCCTGG + Intronic
930551954 2:52847067-52847089 CAGTGAGAACAGATGGACACAGG - Intergenic
930598328 2:53414496-53414518 CAGTGAGAACAGTTGGACACAGG + Intergenic
930926622 2:56825976-56825998 TAGAGAAAACAGCTGGATTCTGG - Intergenic
931367025 2:61627907-61627929 CCATGAAAACAGCTGGGACCAGG + Intergenic
931485538 2:62687081-62687103 AAGTCAAAACAGCTGAAGACAGG - Intronic
932039569 2:68284971-68284993 TAGTGAAAACAGCTTGGGCCTGG - Intronic
932379107 2:71265708-71265730 CAGTGAAAACACATGGACACAGG - Intergenic
934107220 2:88706500-88706522 CAGTGAGAACACATGGAGGCAGG + Intronic
934181953 2:89632581-89632603 CAGGGAGAACAGCTTGAACCAGG - Intergenic
934292257 2:91706806-91706828 CAGGGAGAACAGCTTGAACCAGG - Intergenic
934738677 2:96703471-96703493 GAGTGCAGACAGCAGGAGCCGGG - Intergenic
935395540 2:102604922-102604944 TAGAGAAAACAGCTGCAGACAGG - Intergenic
935492344 2:103735772-103735794 CAGTGGAAGCTGCTGGAGGCAGG + Intergenic
937254612 2:120546368-120546390 CAGTGCAGACATCTGGAGCCAGG - Intergenic
937280256 2:120712793-120712815 CTGTGCCAACACCTGGAGCCAGG + Intergenic
938967032 2:136397760-136397782 CAGAGAATACAACAGGAGCCTGG - Intergenic
939383156 2:141462440-141462462 CAGTGAAAACACATGGACACAGG + Intronic
940405133 2:153292700-153292722 CAGGGAAAAGAGATGGAACCAGG + Intergenic
940730614 2:157386084-157386106 CAGTGAAAACATGTGGACACAGG + Intergenic
941743224 2:169058747-169058769 CAATGAAAACAGATGGACCCAGG + Intergenic
942267670 2:174244715-174244737 CAGGAGAAACAGCTTGAGCCCGG - Intronic
942366700 2:175235812-175235834 CAGTGAAAACACATGGACACGGG + Intergenic
942589828 2:177530759-177530781 CAGAGAAAACAGATGTAGTCTGG + Intronic
942754322 2:179321319-179321341 CAATGAAAACACTTGGAGACAGG + Intergenic
942943911 2:181652667-181652689 AAGTGAAAACAGCTGCAGAATGG + Intronic
944094845 2:195954221-195954243 CAGTGAGAACACCTGGACACAGG - Intronic
944447365 2:199805087-199805109 GAGAAAGAACAGCTGGAGCCTGG + Intronic
946240957 2:218355427-218355449 AAGAGAAAACAGCTGGGCCCGGG - Intergenic
946713172 2:222526810-222526832 CAGTGAAAACACATGGACACAGG + Intronic
947862899 2:233374992-233375014 ACTTGAAAACAGATGGAGCCGGG + Intronic
948601916 2:239112161-239112183 CAGTGAAACCAGCGAGGGCCAGG - Intronic
1169449364 20:5698239-5698261 GAGGGAAAACTGCTTGAGCCAGG - Intergenic
1170096865 20:12655392-12655414 CAGTGAAAACACATGGACACAGG + Intergenic
1172551908 20:35807444-35807466 CAGGGAGAACTGCTTGAGCCTGG - Intronic
1172692907 20:36802942-36802964 CAGTGAGCGCAACTGGAGCCAGG - Exonic
1173314093 20:41927963-41927985 CAGTGCAAACATGTGGAGGCAGG - Intergenic
1173367998 20:42405386-42405408 CAATGAGAACAGGTGGACCCAGG - Intronic
1175952318 20:62590136-62590158 AAGTGTCAGCAGCTGGAGCCTGG + Intergenic
1176342826 21:5714200-5714222 CTTTTAAAACAGGTGGAGCCAGG - Intergenic
1176475080 21:7146351-7146373 CTTTTAAAACAGGTGGAGCCAGG - Intergenic
1176502001 21:7610256-7610278 CTTTTAAAACAGGTGGAGCCAGG + Intergenic
1176511828 21:7754592-7754614 CAGTGAAAGGAGCTGGAGCCCGG - Intronic
1176537147 21:8112269-8112291 CTTTTAAAACAGGTGGAGCCAGG - Intergenic
1176730526 21:10490639-10490661 CAGGGAGAACAGCTTGAACCAGG + Intergenic
1177173215 21:17676642-17676664 AAGAGAAAAGAGCTGGACCCGGG + Intergenic
1178645941 21:34385118-34385140 CAGTGAAAGGAGCTGGAGCCCGG - Intronic
1178901952 21:36605600-36605622 CAGTGGCCCCAGCTGGAGCCAGG + Intergenic
1179293811 21:40042967-40042989 TAGTGAAAACAGTAGGAGCCAGG + Intronic
1182129137 22:27838076-27838098 CAATGAACACAGCCTGAGCCAGG - Intergenic
1183086976 22:35492339-35492361 CAGAGAATACACCTGGAGCAGGG - Intergenic
1183623547 22:38988348-38988370 CAGTGAAGACAGTTGGAGAGGGG + Intronic
1183627355 22:39012832-39012854 AAGCGAAAACAGCTGGGCCCGGG + Intergenic
1184133490 22:42532000-42532022 AAGAGAAAACAGCTGGGCCCGGG - Intergenic
1184702451 22:46185185-46185207 GAGTGAAAACAGATGGAACATGG - Intronic
1184747255 22:46463594-46463616 CGGGGAAAACAGCTGGAGGATGG - Intronic
1185035671 22:48475374-48475396 CAGTGGAAGCTTCTGGAGCCAGG - Intergenic
1185036741 22:48482429-48482451 CAGGGAAAACTGCTTGAACCCGG + Intergenic
1185112384 22:48907749-48907771 AAGAGAAAACAGCTGGGCCCCGG + Intergenic
1185386594 22:50534701-50534723 AAGAGAAAACAGCTGGGCCCGGG - Intergenic
1185420630 22:50732424-50732446 CTGGGCAAACAGCTGGACCCAGG - Intergenic
949149984 3:754929-754951 CAGTGAAACCATCTGGTGCTGGG + Intergenic
949287515 3:2424259-2424281 CAGTGAGAACAGTTGGACACAGG - Intronic
950107047 3:10394870-10394892 CAGTGGAAGGGGCTGGAGCCAGG - Intronic
950797646 3:15523192-15523214 TAGTCAGAACAGCTGGAGGCTGG - Intergenic
952912546 3:38203387-38203409 AAGAGAAAACAGCTGGGCCCGGG - Intronic
953750836 3:45607267-45607289 CAGGGAAACCAGCTGGACACAGG + Intronic
954076927 3:48188286-48188308 CAGCGAAGACAGCGTGAGCCTGG - Exonic
954924895 3:54225147-54225169 CAATGAAAACACCTGGACACAGG - Intronic
956363624 3:68475353-68475375 CAGTGAGAACACATGGAGACAGG - Intronic
956661060 3:71598203-71598225 CAGTGAAAACAGCTGCCTTCCGG - Intergenic
957663023 3:83185226-83185248 CAGTGAAAACACATGGACACAGG - Intergenic
957946706 3:87072501-87072523 CAGTGAAAACAGCATGAACTTGG - Intergenic
958163480 3:89849169-89849191 CAATGAAAACACTTGGAGACAGG + Intergenic
961176640 3:124841197-124841219 CAGTCAAATCAGCCGGAGCTCGG - Intronic
963326910 3:143873581-143873603 AAGAGAAAACAGCTGGGCCCGGG + Intergenic
963405097 3:144853673-144853695 AAGAGAAAACAGCTGGGCCCCGG + Intergenic
963903794 3:150757222-150757244 CAGTGAAAAGAACGTGAGCCAGG - Intronic
964124449 3:153221818-153221840 TGGTGAGAACGGCTGGAGCCAGG - Intergenic
964195049 3:154054149-154054171 CAGTGAAAACAGTGGTAGCCTGG + Intergenic
966097922 3:176228515-176228537 CCATGAGAACAGCTGGAGGCAGG + Intergenic
966194120 3:177297017-177297039 CAGGGAACAAGGCTGGAGCCTGG + Intergenic
966499157 3:180618601-180618623 CAGTGAGAACACGTGGACCCAGG - Intronic
968172466 3:196521618-196521640 AAGAGAAAACAGCTGGGCCCGGG - Intergenic
968794319 4:2692341-2692363 CAGTGGAAACAACTGAAGCGTGG - Intronic
969532789 4:7739156-7739178 TAGTGAAAAGAGGTGGAGCCGGG + Intronic
969543279 4:7807423-7807445 CAGAGGAAACAGCTGTAGCACGG - Intronic
969571059 4:8008635-8008657 CTGTGAACGCAGCCGGAGCCAGG - Intronic
970275092 4:14390865-14390887 CAGTGAAATCAGCTGCAGAGTGG + Intergenic
970423435 4:15926003-15926025 CAGGGCACCCAGCTGGAGCCAGG - Intergenic
972141095 4:35960264-35960286 CACTGAAATCAGCTGCAGACAGG + Intronic
973532585 4:51847747-51847769 CACTGAGGGCAGCTGGAGCCGGG - Intronic
973846885 4:54921887-54921909 CAGAGAAAACAGCTAAAGCAAGG - Intergenic
974469723 4:62302816-62302838 CTCTGAACCCAGCTGGAGCCTGG + Intergenic
974531293 4:63111041-63111063 GAGCAAAAACAGCAGGAGCCGGG + Intergenic
974937551 4:68426121-68426143 CAATGAGAACAGCTGGACACAGG + Intergenic
974997780 4:69183537-69183559 CAGTGAAAACACATGGAAACAGG - Intronic
975435935 4:74351150-74351172 CAGTGAGAAAAGCTGGTGCTTGG + Intergenic
975476594 4:74830737-74830759 CAGTGAAAACACATGGACACAGG + Intergenic
976000641 4:80370264-80370286 CAGTGAAGAAAGGTGGGGCCTGG - Intronic
976254485 4:83085592-83085614 AAGAGAAAACAGCTGGGCCCAGG - Intergenic
976655400 4:87483280-87483302 CAGTGAAAACACATGGACACAGG - Intronic
977176497 4:93826662-93826684 CAGTGTAAGCAGCTAGTGCCTGG - Intergenic
977220671 4:94334088-94334110 TAGTGCAAATAGCTTGAGCCTGG + Intronic
978482542 4:109210741-109210763 CAGGGGAAACAGCTGGAACATGG - Intronic
978495932 4:109358978-109359000 CATTGAGGAGAGCTGGAGCCTGG - Intergenic
980742693 4:136973142-136973164 CAGTGAAAACAGCTGGGAGGGGG - Intergenic
981790042 4:148526346-148526368 CAGGGAACAAAGCTGGGGCCTGG + Intergenic
983064411 4:163192529-163192551 CAGTTTAAGCTGCTGGAGCCTGG + Intergenic
984676116 4:182549601-182549623 CAGTGAAAAGTGCTGGGCCCTGG - Intronic
986429230 5:7665266-7665288 CAGTGATCACAGCTGCCGCCTGG + Intronic
986942807 5:12975903-12975925 CAGAGAAAACACCTGGAGTGAGG - Intergenic
987117110 5:14734543-14734565 CAGTGAAAACCGAAAGAGCCGGG + Intronic
987908771 5:24114392-24114414 CAATGAGAACAGCTGGACACAGG - Intronic
987962772 5:24831934-24831956 CAGAGAACACAGCAGGAGCTAGG - Intergenic
988023180 5:25650384-25650406 CAGTGAGAACACCTGGACACAGG - Intergenic
988073821 5:26326377-26326399 CTGTGAAAACACCTGGATTCAGG + Intergenic
989018768 5:36973874-36973896 CAATGAAAACACATGGACCCAGG - Intronic
989623528 5:43408436-43408458 CAGTGAGAACACTTGGACCCAGG + Intronic
990022308 5:51142835-51142857 CAGTGAAAACACTTGGACACAGG + Intergenic
990245633 5:53860524-53860546 CAGAGAACAAAGCTGGGGCCTGG - Intergenic
991729453 5:69569965-69569987 CATAGAAAACTGCTGGGGCCGGG - Intronic
991805888 5:70425104-70425126 CATAGAAAACTGCTGGGGCCGGG - Intergenic
991865499 5:71057915-71057937 CATAGAAAACTGCTGGGGCCGGG + Intronic
992880708 5:81106526-81106548 CAGAGAAATCAGTTGGAGGCAGG - Intronic
994143001 5:96362027-96362049 CAGTGAGAACACCTGGACACAGG - Intergenic
994332037 5:98517741-98517763 CAATGAACACAGCGGCAGCCTGG + Intergenic
995511382 5:112913442-112913464 GAGTGAGAATAGCTAGAGCCTGG + Intronic
996090482 5:119346243-119346265 CAGTGGAAGCTGCTGGAGGCTGG + Intronic
996902321 5:128556564-128556586 CAATGAGAACAGCTGGACCCAGG + Intronic
997334843 5:133099951-133099973 CAGGGAATGCAGCTGGAGCAGGG + Intronic
997348047 5:133207944-133207966 CAGTAAAAAGAGTAGGAGCCAGG - Intronic
997365057 5:133320319-133320341 CAGTGAAACCAGCAGGGGGCAGG - Intronic
997431500 5:133844138-133844160 CATTGAAAGCAGCTGGATCAGGG - Intergenic
997435700 5:133873348-133873370 CACTGAAAACAGGTGAAACCCGG + Intergenic
997579445 5:135008100-135008122 GGGTGAAAAAAGCTGCAGCCAGG - Exonic
997642848 5:135460761-135460783 CAGTGAACAAATCTGCAGCCGGG - Intergenic
997786083 5:136715279-136715301 CTGTGAAAACAGCTGCACCTGGG - Intergenic
998563480 5:143194043-143194065 CAGTGAAATCAGCAGGACACTGG + Intronic
998800043 5:145859881-145859903 CAGTGAAAACAGCTGTCCTCGGG + Exonic
1000635914 5:163643646-163643668 CAGTGGAGTCAGCTGGACCCAGG + Intergenic
1001559152 5:172658174-172658196 AAGAGAAAACAGCTGGGCCCGGG - Intronic
1001672710 5:173487436-173487458 CACTGGTAACAACTGGAGCCAGG - Intergenic
1002644344 5:180645830-180645852 CAGTGTGTCCAGCTGGAGCCAGG - Intronic
1004327268 6:14686698-14686720 CTGTAAAAACAGATGAAGCCTGG + Intergenic
1005360013 6:25023103-25023125 CAGGGAACAAAGCTGGGGCCTGG + Intronic
1005604037 6:27457342-27457364 GAATGGAAACAGCTGGACCCTGG - Exonic
1005864922 6:29930064-29930086 AAGAGAAAACAGCTGGGCCCGGG + Intergenic
1006397870 6:33798752-33798774 CTGTGCAAACAGCTGGAGCAAGG - Intronic
1006484415 6:34326983-34327005 AAGAGAAAACAGCTGGGCCCGGG + Intronic
1006491210 6:34390042-34390064 CAGGGAGAACAGCTTGAACCCGG + Intronic
1008714830 6:54275624-54275646 CAGTGAAAACACTTGGACACGGG - Intergenic
1008715235 6:54280992-54281014 CAGTGAAAACACTTGGACACAGG + Intergenic
1011161572 6:84396809-84396831 CAATGAGAACACCTGGAGACAGG + Intergenic
1011500464 6:87982610-87982632 CATTGAAGACACCTGGAGGCTGG + Intergenic
1012129923 6:95477380-95477402 CAGTGAGAACACCTGGACACAGG + Intergenic
1012287486 6:97409357-97409379 CAGTGAGAACACATGGAGACAGG + Intergenic
1014068089 6:117150445-117150467 CCATGAAAACAGCTGGAGGGAGG - Intergenic
1014472623 6:121835100-121835122 CAGAGAAAACAGCAGGAACAAGG - Intergenic
1015678799 6:135781240-135781262 CAATGCAAACAGGTGCAGCCAGG - Intergenic
1016256242 6:142109113-142109135 CTATGAAAACAGCTGAAGCAGGG - Intergenic
1016841397 6:148529110-148529132 CTGTGAAAACAGATGAAGCTTGG + Intronic
1017084547 6:150701647-150701669 CAGTGAGAACACCTGGACACAGG - Intronic
1019100629 6:169626411-169626433 CAGAGAAGGCAGCAGGAGCCTGG - Intronic
1019423154 7:960768-960790 AAGAGAAAACAGCTGGGCCCGGG + Intronic
1019924000 7:4180451-4180473 CAGGGCATAGAGCTGGAGCCGGG - Intronic
1020420267 7:7995698-7995720 CAGTGAGAACACCTGGACACAGG + Intronic
1021332790 7:19359346-19359368 CAGTGAGAACACTTGGACCCAGG + Intergenic
1022365820 7:29715072-29715094 CAGTGAGAACAGATGGACACAGG + Intergenic
1024039359 7:45538794-45538816 CAGTGAAACCATCTGGCACCAGG - Intergenic
1024242726 7:47447995-47448017 CAGAGAAGACAGCAGGAGGCTGG + Intronic
1025234846 7:57227593-57227615 AAGTGAAAGCAGTTGAAGCCGGG + Intergenic
1025943670 7:66090687-66090709 GGGTAAAGACAGCTGGAGCCAGG - Intronic
1026849117 7:73713979-73714001 CTGGCAAAACAGGTGGAGCCTGG - Intronic
1027484977 7:78750075-78750097 CAGTGAAAACACATGGAGATGGG - Intronic
1028846392 7:95485595-95485617 CAATAAAAACATCTGGTGCCTGG - Intronic
1029332815 7:99873750-99873772 CAGTGAGAACACCTGGACACAGG - Intergenic
1029827867 7:103219756-103219778 CAGTGAGAACAGATGGACACAGG - Intergenic
1030382233 7:108825336-108825358 AAGAGAAAACAGCTGTAGTCTGG + Intergenic
1030832954 7:114249408-114249430 CAGTGAGAACACCTGGACACAGG - Intronic
1030906285 7:115187407-115187429 CAATGAAAACAGATGGACACAGG - Intergenic
1031462370 7:122067412-122067434 CAGTGCAAACAGCTGGTCTCTGG - Intergenic
1031781503 7:125973213-125973235 CACAGAAAATAGTTGGAGCCAGG - Intergenic
1031948710 7:127868916-127868938 CAGTGCAAAGAACTGGCGCCTGG - Intronic
1032677585 7:134145540-134145562 CATTGAAAACACCTGAGGCCAGG - Intronic
1032722636 7:134563235-134563257 CAGTGGGAAGAGCTGGAGCCTGG - Intronic
1033648631 7:143323399-143323421 CAGTGAAATGAGCTGGGGCCAGG + Intronic
1035052627 7:156009510-156009532 CAGTGAAAACATCTGGGACTGGG + Intergenic
1035066237 7:156107076-156107098 CATTAAAAACAGTTGCAGCCCGG - Intergenic
1035156742 7:156920471-156920493 AAGAGAAAACAGCTGGGCCCGGG + Intergenic
1035432867 7:158835396-158835418 AAGAGAAAACAGCTGGGCCCAGG - Intergenic
1035531614 8:356677-356699 CAGTGAAAGAAGCCGGACCCGGG + Intergenic
1035549426 8:509132-509154 CCATGAAAGCAGCTGGCGCCAGG - Intronic
1037025231 8:14027715-14027737 AAGAGAAAACAGCTGGGCCCGGG + Intergenic
1037079963 8:14772622-14772644 CAGTGAGAACACATGGACCCAGG - Intronic
1037282459 8:17257438-17257460 CAGTGAAAACACATGGATACAGG + Intronic
1037831384 8:22191788-22191810 CTATGAAGAGAGCTGGAGCCAGG + Intronic
1037855913 8:22370526-22370548 CAGTGAAAGAAACTGGATCCAGG + Intronic
1038377583 8:27058040-27058062 CAATGAGAACAGCTGGACACAGG - Intergenic
1038441410 8:27573184-27573206 CTGTGAGAACAGCTGGAGTGGGG + Intergenic
1038514019 8:28169017-28169039 CAGAGACAACAGCTTAAGCCAGG - Intronic
1039309279 8:36298005-36298027 CTGTGAAAACAGCCGGAGTGGGG + Intergenic
1039915887 8:41860005-41860027 CAGAGAAAGCAACTGGAGCAAGG + Intronic
1040848195 8:51868447-51868469 GGGTGAAAACAGGTGAAGCCAGG + Intronic
1041188289 8:55325751-55325773 CAGTGATAACATTTGGGGCCAGG - Intronic
1041573532 8:59366331-59366353 TAGTGAAATCAGCTTGAGACAGG + Intergenic
1041596971 8:59666254-59666276 AAGAGAAAACAGCTGGGCCCGGG - Intergenic
1042933872 8:74039469-74039491 AAGAGAAAACAGCTGGGCCCGGG + Intergenic
1043412199 8:80009223-80009245 CAGCGAAAACACCTGGACACAGG + Intronic
1043593026 8:81851970-81851992 CAGTGAGAACACCTGGACACAGG + Intergenic
1044451686 8:92342883-92342905 AAGTGAAAACAGACTGAGCCTGG - Intergenic
1045005322 8:97912396-97912418 CAGCGAGAGCAGCTGGAGCCGGG + Intronic
1045685766 8:104710012-104710034 CACTGAAAACAGCTGAAGGATGG - Intronic
1045701292 8:104869873-104869895 CAGAGAAAGGAGCAGGAGCCAGG + Intronic
1045878866 8:107014757-107014779 CACTGAAAAGGCCTGGAGCCTGG - Intergenic
1046033289 8:108808930-108808952 CTGAGAAGACAGCTTGAGCCTGG + Intergenic
1046413696 8:113882526-113882548 AAGAGAAAACAGCTGGGCCCAGG - Intergenic
1047383083 8:124382321-124382343 CAGTGAGAACACTTGGACCCAGG - Intergenic
1048042804 8:130747335-130747357 AAGAGAAAACAGCTGGGCCCGGG - Intergenic
1048340042 8:133531608-133531630 CAGTGAAAACACATGGACACAGG + Intronic
1049635088 8:143683926-143683948 AAGAGAAAACAGCTGGGCCCGGG - Intergenic
1049660937 8:143819449-143819471 CAAAGCAGACAGCTGGAGCCAGG + Intronic
1049768314 8:144366189-144366211 AAGAGAAAACAGCTGGGCCCGGG - Intergenic
1050193671 9:3057265-3057287 CAGTGAAAACACATGGACACAGG + Intergenic
1050376194 9:4975897-4975919 CAGTAATCACAGCTGCAGCCAGG - Intergenic
1050617319 9:7415775-7415797 AAGTGAAAACAGCAAAAGCCTGG + Intergenic
1051017728 9:12501228-12501250 CACTGGAAACTACTGGAGCCAGG - Intergenic
1051309852 9:15758180-15758202 CCTTGAAAACAGCTGGAGGAAGG + Intronic
1051365962 9:16321660-16321682 CAGTGGATGCAGCTGGAGGCTGG - Intergenic
1051770362 9:20571634-20571656 CAATGAAAACACATGGACCCGGG - Intronic
1051990107 9:23142878-23142900 CAGTGCATCCAGGTGGAGCCTGG + Intergenic
1051990332 9:23145252-23145274 CCGTGAAAGCAGCTGGGGCAGGG - Intergenic
1052021749 9:23533007-23533029 CAGTGAAGTCAGATGGAGCCAGG - Intergenic
1052207113 9:25855598-25855620 CAATGAAAACAGATGGACACAGG - Intergenic
1052530867 9:29682578-29682600 CAGTGAGAACACCTGGACACAGG + Intergenic
1052798695 9:32947353-32947375 CAGGGAACAAAGCTGGGGCCTGG - Intergenic
1054946860 9:70804973-70804995 CAGTGATGCCAGCTGCAGCCAGG + Intronic
1055626225 9:78179635-78179657 CAGGGAACAAAGCTGGAGCCTGG - Intergenic
1058305281 9:103433782-103433804 CAGTGAGAACACCTGGACACAGG - Intergenic
1059022987 9:110596767-110596789 CAGTGAAAGCAGCTGGGGAAGGG - Intergenic
1060037976 9:120274705-120274727 CAGTGAGAACAGTTGGACACAGG + Intergenic
1060293493 9:122326199-122326221 CAGGGAAAACTGCTTGAACCAGG - Intergenic
1060766614 9:126298718-126298740 CAGTAGAAACAGCTGGAGCAAGG - Intergenic
1061426402 9:130501144-130501166 CAGGGAACAAAGCTGGGGCCTGG - Exonic
1062173807 9:135149657-135149679 AAGAGAAAACAGCTGGGCCCAGG + Intergenic
1062209548 9:135356293-135356315 CTGTGAAAACACCTCGTGCCCGG - Intergenic
1062377641 9:136270219-136270241 AAGAGAAAACAGCTGGGCCCGGG + Intergenic
1203458415 Un_GL000220v1:11750-11772 CTTTTAAAACAGGTGGAGCCAGG - Intergenic
1203583763 Un_KI270746v1:43429-43451 CAGGGAGAACAGCTTGAACCAGG - Intergenic
1188436421 X:30164385-30164407 TAGTGAAAACAGCCGGGGCGCGG - Intergenic
1190320124 X:49175156-49175178 GAGTGGAAACAGCTGGGGCAAGG + Exonic
1191895135 X:65984706-65984728 CAGTGAAAACACATGGACACAGG + Intergenic
1191994903 X:67082607-67082629 CAATGAGAACACCTGGACCCAGG - Intergenic
1192259100 X:69493360-69493382 CAGTTAAAAAACCTGGAGCCTGG + Intergenic
1193127113 X:77881458-77881480 CAGTGAGAACACCTGGACCCAGG - Intronic
1194300645 X:92182061-92182083 CAGTAAAAGCAGCTGGAGGGAGG + Intronic
1194907330 X:99594183-99594205 CAATGAAAACACATGGACCCAGG - Intergenic
1195436221 X:104846390-104846412 CAATGAAAACACCTGGACACAGG - Intronic
1195457408 X:105084327-105084349 CTGTGAAAACAGCTGGGGACCGG + Intronic
1196480342 X:116140905-116140927 CAGGGAGAACTGCTAGAGCCTGG - Intergenic
1198124299 X:133627111-133627133 CAATGAAAACAACTGGACACAGG + Intronic
1198254032 X:134909425-134909447 CAGAGTAAACAGCAAGAGCCAGG - Intronic
1199684172 X:150251417-150251439 CAATGAGAACAGTTGGACCCAGG + Intergenic
1199911289 X:152289710-152289732 CAGTGAAAGCACCTGGACACAGG - Intronic
1200256789 X:154586573-154586595 CAGGGAAAGCTGCTGGAGACAGG - Exonic
1200260980 X:154617830-154617852 CAGGGAAAGCTGCTGGAGACAGG + Exonic
1200267022 X:154652198-154652220 CAGGGAAAGCTGCTGGAGACAGG + Exonic
1201560991 Y:15316460-15316482 CAGAGAAAACACCTGGACGCAGG - Intergenic
1201727406 Y:17168972-17168994 CAGTGAAAACACATGGACACAGG - Intergenic