ID: 1125442850

View in Genome Browser
Species Human (GRCh38)
Location 15:39722048-39722070
Sequence CTGCAAATACAGTTGAACTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 247}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125442850 Original CRISPR CTGCAAATACAGTTGAACTT GGG (reversed) Intronic
900377357 1:2361699-2361721 CTGGAAATGCAGTTGACCCTTGG + Intronic
900766626 1:4510166-4510188 CTGAAAATACAGAGGAATTTAGG + Intergenic
905378118 1:37538872-37538894 CTGAAAATATAGATGAAGTTTGG - Intronic
907841647 1:58163707-58163729 CTGAAAATACACTTGAGCATGGG - Intronic
908068395 1:60432721-60432743 CTCTAAATACAGTTGCAGTTTGG - Intergenic
908822472 1:68102604-68102626 CAGCAAATACAGATGAATATAGG - Intronic
910179003 1:84461155-84461177 CTGTAAGTCCAGTTGAAATTGGG + Intergenic
911157347 1:94650292-94650314 CTACAAAGATACTTGAACTTTGG - Intergenic
911227819 1:95326446-95326468 CTTCAAATACAGCTCATCTTTGG - Intergenic
912600727 1:110930641-110930663 CTCCAAATACAGTTATACTGGGG + Intergenic
913560815 1:120017572-120017594 CTATAAATACACTTGAAGTTTGG + Intronic
913637312 1:120776030-120776052 CTATAAATACACTTGAAGTTTGG - Intergenic
914281398 1:146176985-146177007 CTATAAATACACTTGAAGTTTGG + Intronic
914542443 1:148627920-148627942 CTATAAATACACTTGAAGTTTGG + Intronic
914624190 1:149443323-149443345 CTATAAATACACTTGAAGTTTGG - Intergenic
918027460 1:180765495-180765517 TTTCAAATACAGTTGTCCTTTGG + Intronic
921881252 1:220256924-220256946 ATGCATATGCAGTTGAATTTGGG - Intronic
922117088 1:222623984-222624006 GTGCAAATACAGTTCATCCTTGG + Intronic
922190574 1:223315212-223315234 CTGCAAAGGCAGTTAAGCTTTGG - Intronic
923356536 1:233161452-233161474 CTGGAAAAACAGTTTATCTTGGG - Intronic
924013467 1:239693287-239693309 CTCCAAATACAGTTGCATTGGGG - Intronic
924853264 1:247852203-247852225 ATGCAAATACAGTTGGATCTGGG + Intergenic
1064778364 10:18805432-18805454 CTCCAAATACAATTCATCTTAGG - Intergenic
1066587763 10:36956419-36956441 CTGCCAATTCAGTTGAAAATGGG + Intergenic
1071416089 10:85442822-85442844 CTGCAAATGCTGTTTAACTCAGG - Intergenic
1072190578 10:93073790-93073812 CCGCAATTAAAGATGAACTTTGG + Intronic
1074093226 10:110283354-110283376 CAGCAGAAACACTTGAACTTAGG - Intronic
1074637323 10:115335583-115335605 CAGCTAATACAGTTGTACCTTGG + Intronic
1076332664 10:129681808-129681830 TTGCAAATACAGTTGTTCCTCGG - Intronic
1077440664 11:2567268-2567290 CTGCAAATACAGATGAACCCAGG + Intronic
1077534446 11:3114969-3114991 ATGCAATGAAAGTTGAACTTTGG - Intronic
1077958790 11:7050608-7050630 CTACAAATACAGATCTACTTTGG - Intronic
1078827401 11:14942291-14942313 CTGCAAGAACAGTTTAGCTTTGG + Intronic
1080179405 11:29405874-29405896 CTGCAAATCTAGTTGAAACTGGG + Intergenic
1081307360 11:41529871-41529893 CTGCAGATAGAGTTTAATTTGGG + Intergenic
1082255742 11:50030331-50030353 TTAGAAATGCAGTTGAACTTGGG - Intergenic
1082965010 11:58958232-58958254 CTCCAAATACATTTGGAGTTGGG + Intronic
1084455686 11:69266923-69266945 CTGTAAATACAGATGAAGCTTGG - Intergenic
1085061670 11:73453056-73453078 CTTCAAATACATTTTAACCTTGG + Intronic
1088899910 11:114107890-114107912 CAGAAAATACAGTGGAAATTTGG + Intronic
1088962447 11:114682943-114682965 ATGCAATAAAAGTTGAACTTTGG + Intronic
1092961399 12:13599758-13599780 CTGTAAATAGATTTGAAATTTGG + Intronic
1093475206 12:19547233-19547255 CTGCAAATAATGTTTTACTTAGG + Intronic
1093708286 12:22299746-22299768 ATGCAATAAAAGTTGAACTTTGG - Intronic
1093997225 12:25655319-25655341 CTCCAAATACAGTCGCACTGTGG + Intergenic
1094445530 12:30525541-30525563 CTTTAAATACAGTTGCACTGGGG + Intergenic
1094468023 12:30775001-30775023 ATGCAATAAAAGTTGAACTTTGG - Intergenic
1096292783 12:50355958-50355980 GTGCATACACAGTGGAACTTTGG + Exonic
1097415808 12:59315578-59315600 CTACGAATACAATTGAATTTTGG + Intergenic
1099198094 12:79642705-79642727 CTCCAAATACAGTTCATATTGGG + Intronic
1099769944 12:87038877-87038899 TTGCAAATAGAGTTAGACTTGGG - Intergenic
1100538557 12:95535901-95535923 CTGCAAAAGCAGTTGATTTTTGG + Intronic
1100843224 12:98633928-98633950 CTGAAAATATGGTTGATCTTTGG - Intronic
1101213622 12:102559721-102559743 CTGCAAATACAATTTGAGTTTGG - Intergenic
1104764836 12:131321970-131321992 ATGCAATAAAAGTTGAACTTTGG + Intergenic
1105285177 13:18997590-18997612 CTGAAAATAGAGATGAACATAGG - Intergenic
1108055186 13:46478345-46478367 CTCCTAATACTGTTGCACTTGGG - Intergenic
1109376035 13:61494404-61494426 CTCCAAATTCAGTTAAATTTTGG + Intergenic
1109848025 13:68022827-68022849 CTTAAAATACAGTCGAACTGAGG + Intergenic
1111244927 13:85524812-85524834 CTGCAATTCAAGGTGAACTTTGG + Intergenic
1111519464 13:89381434-89381456 CTCCAAATACAGTTGTATTGGGG - Intergenic
1112683558 13:101795918-101795940 CTGAAAATACAGCTGAATTGAGG + Intronic
1112713076 13:102152544-102152566 CTCCGAATACAGTTGCATTTTGG + Intronic
1113202784 13:107885619-107885641 AAGGAAATACAGTGGAACTTTGG - Intergenic
1113247220 13:108411092-108411114 CTGTAAATACAGATGACCCTTGG + Intergenic
1113285661 13:108845609-108845631 CTCCAAATACAGTTGCATTAGGG + Intronic
1113332699 13:109345973-109345995 CTTCAAAGATAGTTGAAATTGGG + Intergenic
1113375648 13:109762983-109763005 CTGCAAATAAAGTTTTATTTGGG + Intronic
1115193174 14:30768891-30768913 CTGAACAAACAGATGAACTTTGG + Intergenic
1115706025 14:35998862-35998884 CTGCATCTGCAGATGAACTTCGG + Intergenic
1116172409 14:41420337-41420359 CTGCAAATACAGATATAATTGGG - Intergenic
1116992479 14:51291014-51291036 CTGCAAATACAGATTAACATTGG - Intergenic
1120126554 14:80750863-80750885 CTCCAAATACAGTCACACTTGGG - Intronic
1120677213 14:87434467-87434489 CTCCAAACACAGTTGAACTGGGG - Intergenic
1121517426 14:94561798-94561820 CTGCCAATCCAGGTGATCTTGGG + Intronic
1122434010 14:101680162-101680184 ATGCAATAAAAGTTGAACTTTGG + Intergenic
1123190286 14:106562773-106562795 CTAAAAATACAGGTGGACTTAGG + Intergenic
1124681764 15:31738177-31738199 CAGCAAAGACAGAAGAACTTGGG + Intronic
1125442850 15:39722048-39722070 CTGCAAATACAGTTGAACTTGGG - Intronic
1126306875 15:47269003-47269025 CAGCAAAAACAGTTGACATTTGG + Intronic
1126867778 15:52955084-52955106 CTGCAAAGAAAGTTTACCTTAGG + Intergenic
1127063550 15:55213562-55213584 CTGTAAATACAGATGAAACTTGG - Intronic
1127275135 15:57436884-57436906 CTGCAAATAAATTTGAAAATTGG + Intronic
1127372027 15:58350404-58350426 CTGGAAAGACAGTGGACCTTGGG - Intronic
1128661696 15:69505991-69506013 CTGCCCATTCAGTTGAACTATGG - Intergenic
1130185564 15:81677953-81677975 CAGGAAAAACACTTGAACTTGGG - Intergenic
1131586475 15:93700781-93700803 CTTCAAATACAGTTGTTGTTGGG - Intergenic
1132403053 15:101525609-101525631 CTCCAAATACAGTTGCATTGGGG - Intergenic
1134379043 16:13707402-13707424 CTGTAAATACAGATGAAGCTTGG - Intergenic
1135375885 16:21946956-21946978 CTTCACATACAGTTGAATCTGGG - Intergenic
1136925127 16:34364720-34364742 CTGAAAATACAGTTGCGTTTGGG + Intergenic
1136979446 16:35047086-35047108 CTGAAAATACAGTTGCGTTTGGG - Intergenic
1139753280 16:69122231-69122253 TTGCACATACAGTTGACCATTGG - Intronic
1141159641 16:81620569-81620591 CTGCACACACAGCTGGACTTAGG - Intronic
1141350178 16:83287401-83287423 CTGTAAATACAGATGAAGCTTGG - Intronic
1142371128 16:89682983-89683005 TTACAAATACAGTTGAGTTTTGG + Intronic
1142988738 17:3714591-3714613 CTGGAAATACAGTATTACTTAGG - Intergenic
1144040353 17:11405007-11405029 CTGCAGATAAAGTTGAACAGAGG - Intronic
1146441687 17:32901747-32901769 ATGCAATGAAAGTTGAACTTTGG + Intergenic
1148868807 17:50643526-50643548 CTGCAGATACAGTGGCACGTTGG - Intronic
1148951190 17:51314114-51314136 ATGCAATAAAAGTTGAACTTTGG - Intergenic
1149149056 17:53537107-53537129 CAGTAAATACAGTAGAAATTAGG - Intergenic
1150455865 17:65305995-65306017 CTGTAAATACAGATGAAGCTTGG + Intergenic
1153120002 18:1710892-1710914 TTACAAATACAGCTTAACTTTGG - Intergenic
1153762610 18:8346522-8346544 CTCCAAATACAGTCACACTTGGG + Intronic
1155367005 18:25058719-25058741 CTGTAAATACAGATGAAGCTTGG + Intergenic
1156346238 18:36259494-36259516 CTGCAAATAGAATGGAAATTAGG + Intronic
1156369900 18:36463792-36463814 CTGCAAATAAATTGGCACTTGGG - Intronic
1157372749 18:47131928-47131950 CTCCAAATAGAAATGAACTTAGG - Intronic
1157912686 18:51633105-51633127 ATGCAATAAAAGTTGAACTTTGG - Intergenic
1158048426 18:53185989-53186011 CTTCACTTTCAGTTGAACTTCGG - Intronic
1158422298 18:57305998-57306020 CTGCAAATTCAGTTGTGCTGTGG - Intergenic
1165264506 19:34648847-34648869 CTGCAAATTCAGTTTCTCTTTGG + Intronic
1166907304 19:46120246-46120268 CGGAGACTACAGTTGAACTTCGG - Exonic
925701258 2:6640645-6640667 CTGAAAATATAGATGAACTCAGG - Intergenic
927002173 2:18808953-18808975 CTGAAACTATAGATGAACTTAGG - Intergenic
929354051 2:40997749-40997771 TTACAAATGCAGTTTAACTTTGG - Intergenic
929412070 2:41708060-41708082 CTCCAAATACAGTTACACTGGGG + Intergenic
930191797 2:48467147-48467169 CTGCTTATCCAGTTGAGCTTGGG + Intronic
930351382 2:50259958-50259980 CTGCATGTACAGATGAAATTGGG + Intronic
931413218 2:62055014-62055036 CTACAAATACAGATTAACATTGG + Intronic
931447057 2:62335599-62335621 CTCCAAATACAGTCGAATTAGGG - Intergenic
931617771 2:64177977-64177999 CTGCAAATACACTTGAAAATGGG + Intergenic
933794425 2:85908122-85908144 CTGCCAAGACTGCTGAACTTTGG - Intergenic
936159819 2:110076448-110076470 CTCCAAATACAGTTGCATTGGGG + Intergenic
936184846 2:110294905-110294927 CTCCAAATACAGTTGCATTGGGG - Intergenic
937279078 2:120705061-120705083 CTCCAAATGCAGGTGAACCTTGG - Intergenic
937819840 2:126297336-126297358 CTTCCAATACTGTTGAAATTAGG + Intergenic
938020314 2:127901050-127901072 CTCCAGATACAGTTGCACTAGGG - Intergenic
938737008 2:134194911-134194933 CTGATAATGCAGTTGAAGTTGGG + Intronic
940418322 2:153448849-153448871 CTCCAAATACAGTTATATTTAGG - Intergenic
941909773 2:170753158-170753180 ATGCAACTAAAGTTGAACTTAGG + Intergenic
941913217 2:170787289-170787311 CTGTAAATATTGTTGGACTTCGG + Intronic
942131352 2:172883467-172883489 CTCCAACTCCAATTGAACTTTGG + Intronic
943641977 2:190369637-190369659 CTGTATAGCCAGTTGAACTTTGG + Intronic
943963772 2:194303419-194303441 ATACAAATTAAGTTGAACTTTGG - Intergenic
944031478 2:195239832-195239854 CTCCAAATACTGTTGCACTGTGG + Intergenic
944995878 2:205292723-205292745 ATGAACATACAGTTGAATTTGGG + Intronic
946657386 2:221962906-221962928 CTGCACAGTCTGTTGAACTTGGG - Intergenic
947817967 2:233050763-233050785 CTCCAAATACAGTTACACTGGGG - Intergenic
1169342588 20:4807814-4807836 CTGTAATTTCAGTTCAACTTTGG - Intronic
1169540057 20:6590260-6590282 AAGCAAATACAGTAGAGCTTTGG + Intergenic
1169679449 20:8194259-8194281 CTTCAAATCCAGTTCCACTTTGG + Intronic
1169682859 20:8236022-8236044 CTACAAATTCAGTTAAAGTTAGG + Intronic
1170150578 20:13222022-13222044 CTGCCAAAACAGTTGCTCTTAGG - Intronic
1170815439 20:19709750-19709772 CTGCATTTAGAGTTGGACTTTGG - Intronic
1170853914 20:20031050-20031072 CTGCAATTACATTGGAACTGCGG - Intronic
1175012980 20:55758587-55758609 CTGAAATTACAGTTGATCCTTGG - Intergenic
1178475062 21:32930892-32930914 CTGTAAATACAGATGAAGCTTGG + Intergenic
1179258149 21:39735799-39735821 CTGGAAATGCAAGTGAACTTTGG - Intergenic
1179559052 21:42201201-42201223 CTGCAAATACAGATTAACATTGG - Intronic
1180858117 22:19060874-19060896 CTGCACACACATTTGAAGTTGGG - Intronic
1181549406 22:23628472-23628494 CAGCAGAATCAGTTGAACTTGGG + Intronic
1181829582 22:25549258-25549280 CTGTAAATACAGATGAAGCTTGG - Intergenic
1183777417 22:39975630-39975652 CTCCAAGTTCACTTGAACTTGGG - Intergenic
1185099670 22:48831347-48831369 CTGAAACTACAATTGAACTGTGG - Intronic
1185163891 22:49245862-49245884 CTCCAAATACAGTCAAACTGGGG + Intergenic
950918984 3:16674423-16674445 ATGCAATAAAAGTTGAACTTTGG - Intergenic
950955466 3:17048256-17048278 TTGAAAATACAGTTGACCCTTGG + Intronic
952204259 3:31163924-31163946 CTCCACAGACAGTTGGACTTGGG + Intergenic
952333737 3:32387249-32387271 CTCCAAATACAGTCACACTTGGG - Intergenic
955002123 3:54937349-54937371 ATGCAAATACAGTTGTCCCTCGG + Intronic
957469644 3:80641866-80641888 CTGCAAATTCTGTTGATCTTAGG - Intergenic
957845016 3:85721272-85721294 CTGCAAATACATTTGAATCAAGG + Intronic
958103202 3:89040061-89040083 ATAGAAATACAGTTGATCTTTGG - Intergenic
959198788 3:103220428-103220450 CTGCAAAAACTGATGAAGTTCGG + Intergenic
963999944 3:151758416-151758438 CTGCAAATACAATTAAATTGAGG - Intronic
965012609 3:163114394-163114416 CTGGAAAATCACTTGAACTTGGG - Intergenic
968043318 3:195607209-195607231 ATGCAATAAAAGTTGAACTTTGG - Intergenic
968267720 3:197375592-197375614 CTGCAAATGCATTTGAACCAGGG + Intergenic
968269526 3:197392697-197392719 CTCCAAACACTGTTGTACTTGGG - Intergenic
968301244 3:197617645-197617667 ATGCAATAAAAGTTGAACTTTGG + Intergenic
968361027 3:198146972-198146994 CTGCAAACACACGTGAATTTGGG + Intergenic
969727504 4:8930823-8930845 ATGCAATAAAAGTTGAACTTTGG - Intergenic
970301791 4:14689067-14689089 CTGCAGATACAGATGTACATAGG - Intergenic
971863386 4:32138067-32138089 CTGCAAATACAGATTAGCATTGG + Intergenic
971888218 4:32481232-32481254 CTTCAAATAAAGTTGAATTCAGG + Intergenic
972165428 4:36277856-36277878 CTGAAAGTAAAGATGAACTTAGG - Intergenic
973992222 4:56421042-56421064 CTGTAAATACAGATGAAGCTTGG - Intronic
974795944 4:66749795-66749817 CTGAAAATTCACTAGAACTTAGG + Intergenic
976700125 4:87960504-87960526 CTCCCAATACTGTTGAACTGGGG + Intergenic
977042659 4:92033970-92033992 ATGCAATGAAAGTTGAACTTTGG + Intergenic
978316127 4:107439479-107439501 CTGCAAATACAGATTAACATTGG - Intergenic
979623458 4:122821330-122821352 CTGCAAATACAGATTAACATTGG - Intergenic
980071699 4:128249801-128249823 ATGCAATAAAAGTTGAACTTTGG + Intergenic
980648019 4:135670485-135670507 CTCCAAATACACTGGAAGTTAGG + Intergenic
980808195 4:137840781-137840803 CTGCAAATTCAGCTGAAATAAGG + Intergenic
982039959 4:151387556-151387578 CTGCAAATACAGATTAACATTGG - Intergenic
983893030 4:173050642-173050664 GTGTAAATACAGTTGAGCTATGG + Intergenic
984296843 4:177863154-177863176 CTGCAAATATATTTAGACTTGGG + Intronic
984297315 4:177868679-177868701 CTCCAAATACAGTTGCACTGGGG - Intronic
985134490 4:186772119-186772141 CTGGCAAGACAGTTGAGCTTGGG - Intergenic
985173943 4:187181213-187181235 CAGCGAATAAAGTTGAACTTTGG + Intergenic
985362740 4:189192821-189192843 CTCCAAATACAGTTGTCCTGAGG - Intergenic
985946348 5:3187557-3187579 CTGCAAACACAGTTAAAATCTGG - Intergenic
986869960 5:12034274-12034296 CTACAAACACAGTTGTATTTTGG - Intergenic
986914878 5:12607406-12607428 CTGAAAATAAGTTTGAACTTTGG + Intergenic
987010941 5:13763902-13763924 CTGCCAATAGACTTGGACTTTGG - Intronic
987478147 5:18417977-18417999 CTTCAATTACAGTTCAAGTTTGG - Intergenic
989410425 5:41113667-41113689 CTGCCACTACAGTTGACCATGGG - Intergenic
991613978 5:68476974-68476996 CTGTAACTCCAGTTGAACTTTGG + Intergenic
992292710 5:75296075-75296097 ATGCAATAAAAGTTGAACTTTGG - Intergenic
994115900 5:96061100-96061122 CTGCAAATACAGCTACACTGAGG + Intergenic
994671479 5:102766515-102766537 CTGTAAATACAGATGAAGCTTGG + Intronic
995393315 5:111662327-111662349 CTACAAATCAAGTTGAAATTTGG + Intergenic
995615418 5:113957631-113957653 GTGCAAACAGAGTTGAACTCAGG - Intergenic
997666452 5:135633330-135633352 CTCCAAATACAGTTACATTTGGG - Intergenic
999130104 5:149275899-149275921 CTCCAAATACAGTCACACTTGGG + Intronic
999561137 5:152804450-152804472 ATGCAAAAACTGTTGTACTTTGG - Intergenic
1000766171 5:165293088-165293110 CTGAATATACAGTTCAACTGGGG - Intergenic
1000839803 5:166204145-166204167 GTTCAAATACAGTTGCAGTTTGG + Intergenic
1003383497 6:5646566-5646588 CTATAACTACAGTTGGACTTTGG + Intronic
1004646300 6:17564778-17564800 ATGCAATAAAAGTTGAACTTTGG + Intergenic
1008650830 6:53560095-53560117 ATGCAATAAAAGTTGAACTTTGG - Intronic
1010539578 6:77074700-77074722 CTGAAGAAACAGTTAAACTTCGG - Intergenic
1011414484 6:87103193-87103215 CTGAAAATACATTTGACCCTTGG + Intergenic
1012186864 6:96228115-96228137 CTGTAAATATTTTTGAACTTTGG - Intergenic
1013217591 6:108042359-108042381 CTGCAAATAAAAATGTACTTTGG - Exonic
1014887127 6:126795489-126795511 CAGCAAATACAGAAGAACTGGGG - Intergenic
1015089489 6:129338573-129338595 CTGCAATGACACTTGAAATTTGG + Intronic
1016251688 6:142049969-142049991 CTGCAAACACAGTAACACTTTGG - Intergenic
1018382714 6:163273589-163273611 GTGCAAATACATTTGAAATTTGG - Intronic
1018705072 6:166458106-166458128 CTCCAAATACAGTTACACTTGGG - Intronic
1019258983 7:69682-69704 CTGCAAACACACGTGAATTTGGG - Intergenic
1019451949 7:1103520-1103542 CTCCTGATACAGTTGAACTTGGG - Intronic
1020427239 7:8081974-8081996 CTAGAAATACAGTTGAGATTAGG - Intronic
1021909271 7:25368170-25368192 CTGCAAATACATCTAAATTTAGG - Intergenic
1023727875 7:43163276-43163298 TTGCAAATACATTTCACCTTGGG + Intronic
1026316025 7:69228396-69228418 CTGCAAATACAGATGAAGCTTGG + Intergenic
1027609913 7:80347915-80347937 CTGCAATTACAGTAGAAATTAGG - Intergenic
1028545596 7:91996007-91996029 CTGCTAATTCAGTTTAACATAGG - Intronic
1028778724 7:94709753-94709775 CTGCAAAGCCAGTTGAATTTCGG - Intergenic
1030240593 7:107318808-107318830 CTCCAAATACAGTTACACTGGGG + Intronic
1030323975 7:108200449-108200471 CTGAAAATGCAGTGTAACTTAGG + Intronic
1030782680 7:113620979-113621001 ATGCAATAAAAGTTGAACTTTGG + Intergenic
1031227426 7:119057809-119057831 ATGCAATAAAAGTTGAACTTTGG + Intergenic
1031394585 7:121257207-121257229 CTGCAATAAAAGTTGAAGTTTGG + Intronic
1031655594 7:124350713-124350735 CTGCAATGACAGTTGAATATGGG - Intergenic
1031828739 7:126600234-126600256 CTGGAAATACAGTTGACCCTTGG + Intronic
1032650900 7:133877393-133877415 CTTTAAATATTGTTGAACTTTGG + Intronic
1032766393 7:134998111-134998133 CTGCAGATACAGTATAACATTGG - Intronic
1038818902 8:30934231-30934253 CTCCAAATACAGTGGCATTTGGG - Intergenic
1039533294 8:38284118-38284140 CTGCAGTTACAGATGAATTTTGG - Intronic
1041486974 8:58389991-58390013 CTGCACATACAGATGCTCTTTGG + Intergenic
1043612805 8:82086657-82086679 CTGCAAAAACAGTAGAAGTCTGG + Intergenic
1044049131 8:87478140-87478162 CTTGAATTACAGTTGAACTGAGG - Intronic
1049050015 8:140187312-140187334 TTGCAAATACAGTTGTCCCTTGG - Intronic
1050667115 9:7951832-7951854 CTTAAAATACACTTGAAGTTTGG - Intergenic
1050705837 9:8395940-8395962 CTTAAAATACAGTAGACCTTAGG + Intronic
1051853148 9:21532398-21532420 CTGTAAATACAGTTATACTTGGG - Intergenic
1053059340 9:35017746-35017768 ATGCAATAAAAGTTGAACTTTGG + Intergenic
1053585574 9:39455101-39455123 CTGCAAATACAGTTACACTGGGG - Intergenic
1054580737 9:66910124-66910146 CTGCAAATACAGTTACACTGGGG + Intronic
1054933135 9:70657305-70657327 ATGCAATAAAAGTTGAACTTTGG - Intronic
1055110295 9:72552486-72552508 CTGCAAACACTGTTGTATTTGGG + Intronic
1056579613 9:87881248-87881270 CTGCAAATGAAGTAGAACTTAGG + Intergenic
1185978563 X:4749495-4749517 TTACAAAAACAGTTGAATTTCGG - Intergenic
1186204826 X:7190389-7190411 CTGTAAATACAGATGAAGCTTGG + Intergenic
1187089465 X:16080147-16080169 CTGAAAGGACAGTTGACCTTGGG - Intergenic
1187816471 X:23238130-23238152 ATGCAATAAAAGTTGAACTTTGG - Intergenic
1189453346 X:41160452-41160474 CTGCACAAAGAGTAGAACTTTGG - Intronic
1189691400 X:43620657-43620679 ATGCAATAAAAGTTGAACTTTGG + Intergenic
1190956163 X:55196227-55196249 ATGCAATAAAAGTTGAACTTTGG + Intronic
1191142362 X:57130042-57130064 TATCAAATACAGTTGAGCTTTGG + Intergenic
1193061980 X:77216357-77216379 CCTCAAATACAGTTGCACTGGGG + Intergenic
1194886895 X:99327193-99327215 ATGCAATAAAAGTTGAACTTTGG - Intergenic
1197042861 X:121961155-121961177 ATGCAATAAAAGTTGAACTTTGG - Intergenic
1198138864 X:133782694-133782716 CTTCAAATACAAATGAATTTTGG + Intronic
1198316125 X:135468384-135468406 CTGCAAAGGCAATTGAACTAGGG + Intergenic
1199346826 X:146750415-146750437 CTCCAAATACAATTGCACTGGGG + Intergenic
1199887657 X:152037161-152037183 ATGCAATAAAAGTTGAACTTTGG + Intergenic
1200023147 X:153228780-153228802 CTGTACATGCAGTTGAACCTGGG - Intergenic
1201958133 Y:19648452-19648474 CTTCAAATGCACTTGAACTTTGG + Intergenic