ID: 1125445881

View in Genome Browser
Species Human (GRCh38)
Location 15:39755604-39755626
Sequence TCTGATATGCAGAGGGTAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 265
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 248}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125445881 Original CRISPR TCTGATATGCAGAGGGTAGA GGG (reversed) Intronic
902866916 1:19285788-19285810 GCTGCTATGCAGAGGGCACAGGG + Intronic
903848201 1:26290830-26290852 TCAGAGATGCAGAGGGTGGGGGG + Intronic
904979997 1:34491764-34491786 TCTGATATCCAGAGTCTACAAGG + Intergenic
905716400 1:40154437-40154459 TCTGAAATGGAGAGGTTTGAGGG + Intergenic
906567947 1:46813890-46813912 CCTGCTAAGCAGAGGGTAGGAGG - Exonic
906973071 1:50538721-50538743 ACTGATTTGCATAGGGTAAATGG - Intronic
908731250 1:67228822-67228844 TCTTATAAGCAGAAGGGAGAAGG - Intronic
912642491 1:111360774-111360796 AATCATATGCAGAGGGGAGATGG - Intergenic
916771414 1:167912532-167912554 TCTGATTTGCATAGGGTTCAGGG - Intronic
917188696 1:172390513-172390535 ACTGAAATCTAGAGGGTAGAGGG - Intronic
917639851 1:176972972-176972994 TCTGAAATGAGGAGGGAAGATGG - Intronic
918536198 1:185577493-185577515 TCTGATATCCAGAGTCTACAAGG - Intergenic
920656733 1:207882155-207882177 TCCGATATGTAGAGAGAAGAAGG + Intergenic
920993841 1:210967369-210967391 TCTGCTATGCAAAGGATATAAGG + Intronic
921072225 1:211670649-211670671 TCTGGCATCTAGAGGGTAGAGGG - Intronic
921502718 1:215925635-215925657 TCCCTTATTCAGAGGGTAGAAGG - Intronic
922346550 1:224701162-224701184 ACTGCTATGCAGAGAGTGGAAGG + Intronic
924952924 1:248901874-248901896 TCTGATATCCAGAGTCTACAAGG + Intergenic
1063097084 10:2917785-2917807 TCTGATATGGAGGAGGGAGAGGG - Intergenic
1065009938 10:21411865-21411887 TCTGATAGGCAGAGCTCAGATGG + Intergenic
1066226313 10:33386874-33386896 CCTGACAGGCAGAGGGAAGATGG + Intergenic
1066236676 10:33491603-33491625 TCTGCTATACTTAGGGTAGAGGG + Intergenic
1069287018 10:66728309-66728331 TCTAATATCCAGAGTGTACAGGG - Intronic
1072360014 10:94650429-94650451 TCTGATATCCAGAGCCTACATGG - Intergenic
1074389362 10:113044289-113044311 TCGAAAATGCACAGGGTAGACGG - Intronic
1075275443 10:121088971-121088993 ATTGAGATGCAGAGGGTGGATGG + Intergenic
1075700298 10:124464957-124464979 TCTGATGTGTGGAGGGGAGAGGG + Intronic
1078541559 11:12217508-12217530 TCTGTGAGGCAGAGGGAAGAAGG - Intronic
1078758848 11:14235569-14235591 TTTGGTATGCTGAGGGTAGAAGG + Intronic
1081265869 11:41020519-41020541 ACAGACATGCAGAGGGAAGATGG + Intronic
1082644469 11:55704483-55704505 TCTTATAGGCAGAAGATAGATGG - Intergenic
1088385079 11:109245325-109245347 TCTAATATCCAGAGTCTAGAAGG + Intergenic
1090433017 11:126662526-126662548 CCTTATATGCAGAAGGTGGAAGG + Intronic
1091624994 12:2115054-2115076 TGTGAGATGCTGAGGGAAGAGGG - Intronic
1093615440 12:21216775-21216797 TGTGCTCTGCAGAGGGTAAAAGG + Intronic
1095800620 12:46267849-46267871 TCTAAAATGCAGAGGGTGGCAGG - Intronic
1096370326 12:51063957-51063979 TCTGATTTACAGAGGGCAGCTGG + Exonic
1098100205 12:67007141-67007163 GGTGATGGGCAGAGGGTAGAGGG + Intergenic
1098467110 12:70800230-70800252 TCTAAAATGCAGTGGGTAGGGGG - Intronic
1099240659 12:80134843-80134865 TCTGATATGCAGAGATATGAGGG - Intergenic
1099564972 12:84231047-84231069 TCTCACATGAAGAGAGTAGAGGG - Intergenic
1100258387 12:92907382-92907404 TCTGAGATGGAGAATGTAGATGG - Intronic
1101075411 12:101124348-101124370 TCTGATATCCAGAGTCTACAAGG - Intronic
1102450769 12:113040410-113040432 TCATAGATGCAGAGAGTAGAAGG - Intergenic
1103719020 12:122963694-122963716 TCTGAGATGCAGAGGGGGAATGG + Intronic
1104634352 12:130428222-130428244 TCTGAAATGCAGCTGGAAGATGG - Exonic
1104724558 12:131067771-131067793 TCAGACATACAGAAGGTAGAGGG - Intronic
1105058411 12:133125725-133125747 TCTGCCATGAAGAGGATAGAAGG + Intronic
1105663281 13:22523439-22523461 ACTGATATGCAGACTGTGGAAGG + Intergenic
1106171761 13:27294739-27294761 AGAGATATGCAGAGGGAAGATGG + Intergenic
1108359478 13:49656218-49656240 TGTGATGGGCAGAGGATAGAAGG + Intergenic
1111032833 13:82629382-82629404 TCTCATAGGCAGAGGCTACAGGG - Intergenic
1112129166 13:96502419-96502441 TCTGATATGGAGAGGGAAATGGG + Intronic
1112452814 13:99527191-99527213 ACTAATATTCAGAGGGTAGAGGG + Intronic
1115713219 14:36073182-36073204 ACTCCTATGCAGAAGGTAGAAGG - Intergenic
1116605442 14:46987475-46987497 TCCTTTATGCAGAGGGCAGAAGG + Intronic
1117360798 14:54971789-54971811 TCTGATATCCAGAGTCTATAAGG + Intronic
1117664202 14:58039328-58039350 TCTGATAAACAGAGGCAAGATGG - Intronic
1118054923 14:62069886-62069908 TCTCAGATGCAGAGTGCAGAGGG - Intronic
1119319453 14:73720985-73721007 TCTGAGATTCAGAGGGAAAAAGG - Intronic
1119438074 14:74611093-74611115 TCTGAGAGGCAGCGGGGAGAGGG - Intronic
1119462946 14:74825957-74825979 TCTGAGAAGCAAATGGTAGACGG - Intronic
1120213770 14:81660283-81660305 ACTGAATTCCAGAGGGTAGAAGG + Intergenic
1120824134 14:88940002-88940024 ACTATTAGGCAGAGGGTAGAGGG - Intergenic
1121732047 14:96193889-96193911 TCCGATGTGTAGCGGGTAGAGGG + Intergenic
1121962042 14:98269898-98269920 TAAGCTATGGAGAGGGTAGAAGG + Intergenic
1124882945 15:33659108-33659130 GCTGATGTGCAGTGGGCAGAGGG + Intronic
1125445881 15:39755604-39755626 TCTGATATGCAGAGGGTAGAGGG - Intronic
1126103133 15:45131344-45131366 TGTGATATAGAGAGGGTAGGCGG - Intronic
1126244117 15:46483799-46483821 TATGGTGTGCAGAGGGAAGATGG + Intergenic
1126450841 15:48807127-48807149 TCTGAGAAGCAGAGGCTGGAGGG - Intronic
1127499559 15:59543683-59543705 TCTGAAATTCTGAGGGTATAAGG + Intergenic
1130412994 15:83662915-83662937 TCTGCTACCCAGAGGGCAGAGGG - Intronic
1130815378 15:87426579-87426601 GCTGATATGCAGATGGCAGAAGG - Intergenic
1131090040 15:89617113-89617135 TCTGAAAGGCAGAGAGAAGAAGG - Intronic
1131867807 15:96730710-96730732 CCAGAGAAGCAGAGGGTAGAGGG + Intergenic
1132011364 15:98279477-98279499 TCTGATCTGCAGAGAGAAGGTGG + Intergenic
1132028970 15:98425278-98425300 TCTGATATGCAGGGGAGGGAAGG + Intergenic
1132478273 16:153333-153355 TCTGACAAGCAGAGGGTGAAAGG + Intronic
1132480358 16:163923-163945 TCTGACAAGCAGAGGGTGAAAGG + Intronic
1133496487 16:6323030-6323052 CCTTATATGCAGAGGGAAGCTGG - Intronic
1133549994 16:6845059-6845081 TCTAATATCCAGAGTGTACAAGG - Intronic
1133694635 16:8250224-8250246 TCTGCAATGCAGAAGGTGGAGGG + Intergenic
1135847994 16:25936305-25936327 TCAGATATGCAGATGATACAAGG + Intronic
1137412358 16:48239782-48239804 TCTAATATCCAGAGTCTAGAAGG + Intronic
1138213582 16:55183339-55183361 TCTGACATGTAGGGTGTAGAGGG - Intergenic
1138226012 16:55295318-55295340 TATGATATTCAGAGGTTAGAGGG - Intergenic
1138481432 16:57305815-57305837 CCTGATAGGCAGGGAGTAGAGGG + Intergenic
1141526815 16:84617314-84617336 TCGGATGTCCAGAGGGGAGAAGG + Intronic
1142497042 17:311410-311432 TCTGAAAGGCTGAGGGCAGAGGG - Intronic
1144426903 17:15151711-15151733 TCTGAAATGGAGAGGGAAGAGGG - Intergenic
1146649638 17:34598636-34598658 TTTGATGTGCAGAAGGTGGAAGG + Intronic
1146967572 17:37045929-37045951 TCTGATTTGCAGAGGCAGGAAGG + Intronic
1147304945 17:39556730-39556752 TCTCCTATCCATAGGGTAGATGG + Intronic
1148136315 17:45294160-45294182 ACTCTTATGCAGAGAGTAGAGGG - Intronic
1150457176 17:65315732-65315754 TATGGTATCCAGAGTGTAGAAGG - Intergenic
1150948927 17:69779964-69779986 TCCAATTTGCAGACGGTAGAAGG - Intergenic
1151422997 17:74010833-74010855 TCTGATATCCAGAATCTAGAAGG + Intergenic
1152361981 17:79837047-79837069 TCTGTTTCGGAGAGGGTAGAAGG - Intronic
1155808869 18:30206699-30206721 TCTGATATGGACAGGAGAGAGGG - Intergenic
1156362579 18:36397286-36397308 TCTGTTCAGCAGAGAGTAGAGGG - Intronic
1156445121 18:37230951-37230973 TGTGAGCTGCAGAGGGGAGAAGG - Intronic
1157182469 18:45509930-45509952 TCTGTTAGGCAGAGGATGGATGG - Intronic
1158851461 18:61499192-61499214 TCAGATATGGACAGGGGAGACGG + Exonic
1159296627 18:66498564-66498586 TCAGATATGCGAAGGCTAGATGG + Intergenic
1166430585 19:42723279-42723301 TCTGCAGTGCAGATGGTAGAGGG + Intronic
1167782463 19:51608060-51608082 TCTCAAATGCAGAGGTAAGAAGG - Intergenic
925488348 2:4362544-4362566 TCTTAGAAGCAGAGAGTAGATGG - Intergenic
927249539 2:20985248-20985270 TCTGCTATGCACAGAGTAGAAGG + Intergenic
927390923 2:22594487-22594509 TCTAATATCCAGAGTCTAGAAGG + Intergenic
927577628 2:24212653-24212675 TCTGATGAGCAGTGGGTAGCGGG + Exonic
931151192 2:59575337-59575359 CCTGCTATATAGAGGGTAGATGG + Intergenic
933537180 2:83590772-83590794 TTTGAAAGGCAGAGGGAAGAGGG + Intergenic
933970635 2:87467171-87467193 TCTGGCAAGCAGAGGGCAGATGG - Intergenic
936323094 2:111483011-111483033 TCTGGCAAGCAGAGGGCAGATGG + Intergenic
938136365 2:128761072-128761094 TCTAATATGCAGAGTCTACAAGG - Intergenic
939619860 2:144405512-144405534 TGTGACATTCAGAGGGTGGAGGG - Intronic
940853905 2:158714964-158714986 TCTGAAAGGTAGAGGGAAGAAGG - Intergenic
941139369 2:161759512-161759534 TCATATAAGCAGAGTGTAGAAGG - Intronic
941339153 2:164284655-164284677 ACTGGTTTCCAGAGGGTAGAGGG + Intergenic
946311493 2:218884551-218884573 TCTGAGAAGTAGAAGGTAGAAGG - Intronic
947371031 2:229445849-229445871 TCTGACATTCAGAGGGAATAGGG - Intronic
947653868 2:231809882-231809904 TCTCATATGCAAAGCGAAGATGG - Intergenic
948116244 2:235495606-235495628 CCTGACATGCAGAGGGAAGCGGG - Intronic
1169413189 20:5392260-5392282 TCAACTATGCAGAGGGAAGAGGG - Intergenic
1170119260 20:12894135-12894157 GCTGATATGCAGAGTGCTGAGGG - Intergenic
1170172731 20:13433486-13433508 TACTATGTGCAGAGGGTAGAAGG + Intronic
1170485152 20:16807980-16808002 TCTGAGAGGAAGAGGGAAGAAGG + Intergenic
1170738511 20:19031859-19031881 TCTGACTTGCAGAGTGTGGAAGG - Intergenic
1171517292 20:25747612-25747634 GCAGATATTCAGAGGGTAGGAGG + Intergenic
1172593789 20:36135629-36135651 TCAGATATGTAGAGGGAAGCAGG - Intronic
1174433509 20:50488670-50488692 TCTGAAATGCAGATGGTAATAGG + Intergenic
1175007285 20:55698520-55698542 TCTTAGATTCAGAGGGTACATGG + Intergenic
1177859991 21:26441056-26441078 TCTGCTATGGAGAGGGGAGCTGG + Intergenic
1180011036 21:45051698-45051720 CCTCACATGCAGAGGGTAGCTGG - Intergenic
1181861455 22:25822383-25822405 TCTGTTTGGCAGAGGGCAGAGGG + Intronic
949359274 3:3214654-3214676 TCTGCTCTCTAGAGGGTAGAAGG - Intergenic
951897193 3:27620977-27620999 TCTGATATCCAGAGTCTACACGG - Intergenic
954592960 3:51799694-51799716 CCTGCAATGCAGAGGGAAGATGG + Intergenic
956152931 3:66262142-66262164 TCTTATATGAAGAGGTGAGATGG + Exonic
957976286 3:87448838-87448860 CTTGATATGCAGAGGTAAGAAGG + Intergenic
958255891 3:91324468-91324490 TCTGATGTGCAAAGTGCAGAAGG + Intergenic
958602901 3:96321597-96321619 TCTAATATGCAGAGTCTATAAGG + Intergenic
958958680 3:100488630-100488652 TGTGATATACAGAGGAAAGAGGG - Intergenic
960121884 3:113955466-113955488 CCTGGCATGCAGTGGGTAGAAGG + Intronic
960500359 3:118430462-118430484 TCTGATATCCAGAATGTATAAGG - Intergenic
960500440 3:118431246-118431268 TCTGATATCCAGAATGTATAAGG - Intergenic
961045497 3:123705119-123705141 TCCGGTGTGCAGGGGGTAGAGGG - Intronic
961648660 3:128406315-128406337 TCATAGAAGCAGAGGGTAGAAGG + Intronic
961835640 3:129656294-129656316 TCTGTCAGGCAGAGGGCAGATGG + Intronic
962722522 3:138188616-138188638 TCTGATACTGAGAGGGTAGTTGG + Intronic
963752743 3:149200026-149200048 TCTGATATGTCGAGGTTGGAAGG + Intronic
964671273 3:159228992-159229014 TATAATATGCAGGGGGTAAATGG + Intronic
964889071 3:161516594-161516616 TCTGATATCCAGAGGGGAAGAGG - Intergenic
965439220 3:168692045-168692067 TCTGATTGGCAGTGGGGAGAGGG + Intergenic
966899392 3:184469440-184469462 TCTGACATGCAGAGGGTCCGGGG + Intronic
966921272 3:184613189-184613211 TCTGATACCCAGAGTGTGGATGG + Intronic
967059626 3:185860678-185860700 TCTGATATGCAGAATCTATAAGG + Intergenic
967106083 3:186256089-186256111 GCTGATCTGCAGAGGGTGGATGG - Intronic
967394116 3:188987680-188987702 TCTGAAAGGCAGAGAGAAGAAGG - Intronic
969851616 4:9961823-9961845 TCTAATATCCAGAGTCTAGAAGG + Intronic
970186191 4:13455840-13455862 TCTGATCTGGACAGGGGAGATGG + Intronic
970324037 4:14904510-14904532 GCTGAAATGCAGAGGTTAAATGG - Intergenic
971075226 4:23140351-23140373 TTTGATAAGAAGAAGGTAGATGG - Intergenic
973261373 4:48167735-48167757 TGTGATATGCAGTGGGTAGGTGG - Intronic
974234719 4:59166344-59166366 TCTAATATGCAGAGTTTATAAGG + Intergenic
975259330 4:72277880-72277902 TCTTATATGCCAAGGGAAGAAGG - Intergenic
975831442 4:78373230-78373252 TATGGTATACAGAGGGTTGAAGG - Intronic
976364838 4:84221830-84221852 TGTGAAATGCAGAGGGAAGTGGG + Intergenic
976941739 4:90710166-90710188 TCTAATATCCAGAGTCTAGAAGG - Intronic
977430188 4:96922202-96922224 TCTAATATCCAGAGGCTATAAGG - Intergenic
978498807 4:109386920-109386942 TCTGATTTGCATAGGGTCCATGG + Intergenic
978522959 4:109635563-109635585 TCTGATTTGCATAGGGCACAGGG - Intronic
980681947 4:136174301-136174323 TCTGATATACAAATGGAAGAAGG + Intergenic
981244408 4:142517110-142517132 CCTGGTATGCAGAGGGTGGAAGG - Intronic
981903861 4:149896832-149896854 CCAGAAATGCAGAGGGGAGAGGG + Intergenic
982479101 4:155887270-155887292 TGTGATAAGTAGAGGGTAGAGGG - Intronic
984938774 4:184913131-184913153 TCTGATATTCAGAGGTTGGTAGG - Intergenic
985044299 4:185924696-185924718 TCTGATTTGCATAGGGCACAGGG - Intronic
986971493 5:13342398-13342420 TCTGATATCCAGAGTCTACAAGG + Intergenic
987431307 5:17837052-17837074 TCTAATATGCAGAGTCTACAAGG - Intergenic
988268528 5:28983938-28983960 TCTAATATGCAGAGCTTAAAAGG - Intergenic
988353237 5:30139964-30139986 TTTGATATGCAAAGGATAGAAGG - Intergenic
988523334 5:31965306-31965328 TCTGATTTGCATAGGGCACAGGG + Intronic
988779520 5:34507374-34507396 TGTGATTTGCAGAGGATAGCAGG - Intergenic
989214289 5:38888158-38888180 TCTGATTTGCATAGGGCTGAGGG + Intronic
989259059 5:39398827-39398849 TTTAACATGCAGTGGGTAGAAGG + Intronic
990250375 5:53907860-53907882 TCTGAAATACTGAGTGTAGAGGG - Intronic
990254583 5:53953605-53953627 TTTCATATGAAGAGGGTGGAGGG + Intronic
990767866 5:59207267-59207289 TTTAATATACAGAGGGAAGAGGG + Intronic
992520045 5:77541215-77541237 TCTAATATGCAGAGTCTACAAGG + Intronic
994395896 5:99225550-99225572 CCTGATATGCAGAGGGGGAAAGG - Intergenic
994723232 5:103404395-103404417 TCACATATAGAGAGGGTAGAGGG - Intergenic
996008243 5:118449722-118449744 TTTGCTATGCAGAGGGGAGTGGG - Intergenic
996697202 5:126410989-126411011 TCTAATATGCAGAATCTAGAAGG - Intronic
997683666 5:135773823-135773845 TCTAATATCCAGAGGGGGGAGGG + Intergenic
997685699 5:135786226-135786248 TCGTATATTCAGAGGGGAGAGGG + Intergenic
997824002 5:137090402-137090424 TGTGATCTGCAGAGGGAGGAAGG - Intronic
998406324 5:141876601-141876623 TCTGACTTACAGAGGGTAGCTGG + Intronic
998757651 5:145398486-145398508 ACTGGTATGCAGAGGGTTTAGGG - Intergenic
998935707 5:147230219-147230241 CCTGATATCCAGTGGGGAGAGGG + Intergenic
1000585555 5:163093677-163093699 TATGGGATGCATAGGGTAGAGGG - Intergenic
1000679622 5:164167209-164167231 TCTAATATTCAGAGTGAAGATGG - Intergenic
1002602244 5:180360676-180360698 TCGGATGTGCTGAGGGGAGAGGG + Intergenic
1002938015 6:1690621-1690643 TCTAATATGCAGAGTCTACACGG + Intronic
1004037603 6:11938861-11938883 TCTGTAAGGCAGGGGGTAGATGG + Intergenic
1004417550 6:15438456-15438478 TGTGAATTGCAGAGCGTAGAAGG + Intronic
1005268185 6:24135254-24135276 TTGGATATGCTGATGGTAGAAGG + Intronic
1005787500 6:29260881-29260903 TCTTATGTACAGAGGGCAGATGG + Intergenic
1007033037 6:38646383-38646405 TCTAAAAAGCAGATGGTAGAGGG - Intergenic
1008464701 6:51817465-51817487 TATGATATACTGAGGGGAGAGGG + Intronic
1008999450 6:57696705-57696727 TCTGATGTGCAAAGTGCAGAAGG - Intergenic
1009187936 6:60596109-60596131 TCTGATGTGCAAAGTGCAGAAGG - Intergenic
1009484003 6:64197224-64197246 TCTCAACAGCAGAGGGTAGATGG - Intronic
1014588526 6:123231912-123231934 TGGGATATGGAGAGGGTAGAAGG + Intronic
1016473555 6:144401408-144401430 TTTGATATGAAGATGGTAAAGGG + Intronic
1019935751 7:4256349-4256371 TCTGATATTCAGAGGGGACTGGG + Intronic
1021645149 7:22782397-22782419 CCTGACAGGCAGAGTGTAGAAGG - Intergenic
1022250827 7:28606538-28606560 ACTGAGAGGCAGAGGGAAGATGG - Intronic
1022279325 7:28890234-28890256 TCTGATTTGCATAGGGTCCAGGG + Intergenic
1022859625 7:34354224-34354246 TCTCATATGCAGAGGCCAGATGG - Intergenic
1023257851 7:38329605-38329627 TCTAATATCCAGAGGGGACATGG + Intergenic
1026098662 7:67367009-67367031 TTAGAGATGCAGAAGGTAGAAGG + Intergenic
1027246592 7:76371744-76371766 TCTGATCTGCACAGGATAGCTGG - Intergenic
1027403353 7:77831956-77831978 TCTTATATGCAGAAGTAAGATGG + Intronic
1030523969 7:110631061-110631083 TCTGATATTCAGAGGAGATAAGG + Intergenic
1031291097 7:119936195-119936217 TGTAAAATGCAGAGGGTAGAAGG + Intergenic
1031492902 7:122411119-122411141 TCTGATCTGCTGATGGTAGATGG - Intronic
1031626626 7:123999753-123999775 TCTGATATGCAGAATCTATAAGG + Intergenic
1032332203 7:130990967-130990989 TCTGCTATGCATACTGTAGAAGG + Intergenic
1032488853 7:132308876-132308898 CCTGATATAAAGAGGTTAGAAGG + Intronic
1033769954 7:144538871-144538893 TCTAATATACAGAGGCTATAAGG + Intronic
1033923662 7:146428628-146428650 TCTAATATACAGAGGCTACAAGG - Intronic
1034727465 7:153351026-153351048 TCTGAAAGGTAGAGGGGAGAAGG - Intergenic
1037422160 8:18714389-18714411 TCTGATATCCAGAGACTACAAGG + Intronic
1038650852 8:29402009-29402031 TCTGATAAAGAGAGGGAAGAGGG - Intergenic
1038723388 8:30058210-30058232 TCTGATATCCAGGTGGTAGCAGG + Intergenic
1039436491 8:37563021-37563043 TTTGATATGCAGTTGGTGGATGG - Intergenic
1039878757 8:41610127-41610149 TCTGATATGCAGAGAATCCAAGG - Intronic
1040401719 8:47057151-47057173 TCTGATTTGCATAGGGTCCAGGG + Intergenic
1040854906 8:51938608-51938630 TCTAATCTGCAGAGGATACAAGG + Intergenic
1042014525 8:64293336-64293358 TCTGAGAGGCAGTGGGAAGAAGG - Intergenic
1042586097 8:70340202-70340224 TCTGATATCCAGAGTCTACATGG + Intronic
1042682410 8:71400408-71400430 TCTAATATCCAGAAGGTACAAGG + Intergenic
1049411294 8:142475138-142475160 GATGGTAAGCAGAGGGTAGAGGG - Intronic
1051572698 9:18578366-18578388 TCTGAGATGCAGGGTGAAGAGGG - Intronic
1054878413 9:70120570-70120592 TCTCATATGCACAGGCTACAAGG + Intronic
1055133105 9:72797980-72798002 TCTAATATGCAGAGTCTACAAGG + Intronic
1055776864 9:79775781-79775803 TCTGAAATCCAGAAGGGAGAGGG + Intergenic
1056797823 9:89670678-89670700 TCAGACATGTGGAGGGTAGATGG + Intergenic
1056813904 9:89786371-89786393 TCTGAAAAGCAAAGGGTAGCAGG + Intergenic
1058519338 9:105803293-105803315 CCTAATATCCAGAGGGGAGAAGG - Intergenic
1058868037 9:109179683-109179705 TCTGATTTGCAGAATGTGGATGG - Intronic
1187471081 X:19570283-19570305 TCTGTGAGGCAGAGGGTAGTGGG + Intronic
1189406180 X:40726238-40726260 TCTAATAAGCACAGGGTATAGGG - Intronic
1189874593 X:45422524-45422546 TCTGATATCCAGAATGTATAAGG + Intergenic
1190949768 X:55132076-55132098 TCTCATATGCCAAGGATAGATGG + Intronic
1191204860 X:57822866-57822888 TCTGATTTGCATAGGGTCCAGGG + Intergenic
1194922552 X:99784468-99784490 TATTTTATTCAGAGGGTAGAGGG + Intergenic
1195555098 X:106212629-106212651 TCTGCTAGGCTGAGGGTTGAGGG - Intergenic
1196046054 X:111257706-111257728 GCTGAGATGCAGAGTGCAGATGG + Intronic
1196132442 X:112171972-112171994 TCTGATATCCAGAGTGTAGAAGG + Intergenic
1196363655 X:114898282-114898304 TCTAATATCCAGAGTGTACAAGG - Intronic
1198063351 X:133070173-133070195 ACAAATATGAAGAGGGTAGAAGG + Intronic
1199814204 X:151383232-151383254 TCTGATATGGAGGTGGGAGAAGG + Intergenic