ID: 1125448386

View in Genome Browser
Species Human (GRCh38)
Location 15:39782631-39782653
Sequence GTTCCTCGAGGAGGCCCGGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 139}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125448386_1125448395 5 Left 1125448386 15:39782631-39782653 CCCGCCGGGCCTCCTCGAGGAAC 0: 1
1: 0
2: 0
3: 9
4: 139
Right 1125448395 15:39782659-39782681 GCCGTCAGTCAGGGCGCAGATGG 0: 1
1: 0
2: 0
3: 5
4: 67
1125448386_1125448393 -4 Left 1125448386 15:39782631-39782653 CCCGCCGGGCCTCCTCGAGGAAC 0: 1
1: 0
2: 0
3: 9
4: 139
Right 1125448393 15:39782650-39782672 GAACTGGCCGCCGTCAGTCAGGG 0: 1
1: 0
2: 0
3: 2
4: 42
1125448386_1125448392 -5 Left 1125448386 15:39782631-39782653 CCCGCCGGGCCTCCTCGAGGAAC 0: 1
1: 0
2: 0
3: 9
4: 139
Right 1125448392 15:39782649-39782671 GGAACTGGCCGCCGTCAGTCAGG 0: 1
1: 0
2: 0
3: 2
4: 54

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125448386 Original CRISPR GTTCCTCGAGGAGGCCCGGC GGG (reversed) Exonic
900240870 1:1616573-1616595 GAGCCTCAAGGCGGCCCGGCGGG + Exonic
900738947 1:4318888-4318910 GCTCCTGGGGGAGGCCCGCCTGG + Intergenic
901514406 1:9735277-9735299 GTTCCTGGAGTGGCCCCGGCAGG - Intronic
903174865 1:21574853-21574875 GAGCCTCGCGGTGGCCCGGCAGG - Intronic
904034841 1:27553003-27553025 GTACCTGGAGGAGGCTGGGCCGG - Intronic
904468010 1:30719319-30719341 GTGCCCCCGGGAGGCCCGGCCGG + Intronic
905874205 1:41422071-41422093 GCTCCTCGGGGAGGGCCGGCTGG + Intergenic
906495393 1:46301765-46301787 GTTCCACCAGGAGGCCTTGCGGG - Intronic
906545943 1:46619536-46619558 GTTCTTCTAGGAGGCTCTGCTGG + Intergenic
911094341 1:94043405-94043427 GTCCCAGGAGGAGGCCCAGCTGG - Exonic
914045284 1:144086236-144086258 TTTCCTAGAGGAGGCCAGGGAGG + Intergenic
914132826 1:144874450-144874472 TTTCCTAGAGGAGGCCAGGGAGG - Intergenic
915318569 1:155043426-155043448 GTACCGCCAGGAGGCCCGGCTGG + Exonic
915355002 1:155250621-155250643 TTTCCTCGAAGGGGCCCCGCAGG + Exonic
920657521 1:207887783-207887805 GTTTCTGGAGGTGGCCTGGCCGG + Exonic
921063942 1:211609589-211609611 GTTCCTGGTGCAGGCCCGGTAGG + Intergenic
921221018 1:212974037-212974059 GCCCCCCGAGGAGGCTCGGCCGG + Exonic
924206276 1:241714141-241714163 GTTCCTCAAGGAGGCCAGGGTGG + Intronic
1063034870 10:2276574-2276596 GTGCTTAGAGGAGGCCCAGCAGG + Intergenic
1070914471 10:80144267-80144289 GCTCCTCCAGCAGGCCCAGCAGG - Exonic
1071997482 10:91162717-91162739 GCGGCTCGAGGAGGCCTGGCGGG + Intergenic
1073417402 10:103395973-103395995 GCACCTAAAGGAGGCCCGGCTGG + Exonic
1074108854 10:110408561-110408583 GCTCCTCGTGGAGGCCCTGGGGG - Intergenic
1075682778 10:124344250-124344272 GTTCCCCCAGGTGGCCCGGGAGG + Intergenic
1076567641 10:131409835-131409857 GTTCTTCCAGGAGGCTTGGCGGG - Intergenic
1076625072 10:131816578-131816600 TTTCCTTGAGGAGTCCAGGCCGG + Intergenic
1081617820 11:44601033-44601055 CTTCCTGGAGGAGGCCGAGCAGG - Intronic
1083332575 11:61905818-61905840 GTTCCTCCAGCAGCCCCGGGAGG + Intronic
1085641678 11:78196806-78196828 GTTCCTAGAGCAGGCCCAGCAGG + Exonic
1089200572 11:116722486-116722508 GCTCCTGGAGGAGGCCTGGATGG - Intergenic
1091222331 11:133936772-133936794 GTTCCTCCAGGAGGCAGGGCTGG + Intronic
1092077190 12:5683810-5683832 CTTCCTGGAGGAGGCAGGGCAGG + Intronic
1097119289 12:56719287-56719309 GTACCTGGAGGAGTCCCAGCTGG + Intronic
1105004164 12:132710814-132710836 GTTCCTCGCGGAGCGCCGTCGGG + Exonic
1109309872 13:60680052-60680074 CTTCCTCCAGGAGGCCTGCCAGG - Intergenic
1112226548 13:97545588-97545610 GCTCCTTGGGGAGGCCCGGGAGG - Intergenic
1113806138 13:113110748-113110770 GTTCCTGGAGGAGCTGCGGCCGG + Exonic
1113914748 13:113863655-113863677 GGTCTTCGAGGAGGCCAAGCAGG - Exonic
1116390568 14:44385046-44385068 GTTCGTCGAGGAGGCTTGGGCGG - Intergenic
1118932463 14:70255146-70255168 GCTCGTCGAGGAGGCTCGGGCGG - Intergenic
1122971970 14:105156032-105156054 GTTCCTGGAGGACCCCTGGCCGG - Intronic
1202935706 14_KI270725v1_random:85851-85873 TTTCCTAGAGGAGGCCAGGGAGG - Intergenic
1125448386 15:39782631-39782653 GTTCCTCGAGGAGGCCCGGCGGG - Exonic
1127224743 15:56918072-56918094 GTTCCGAGAGTAGGCGCGGCCGG - Intronic
1132523237 16:401108-401130 GTTCCGCGTGGGGGCCCGGGCGG - Intronic
1132551683 16:556310-556332 GGTCCTAGAGGAGCCCTGGCCGG - Intergenic
1132678153 16:1129209-1129231 CTGCCCCGAGGAGGCCGGGCGGG + Intergenic
1133055686 16:3144446-3144468 GTTCCTCGAGGAAGCCCTAGGGG - Exonic
1138228829 16:55323618-55323640 GCTCCTCCTGGACGCCCGGCTGG - Intergenic
1140639965 16:76960189-76960211 CTTCCACGAAGAGGCCCTGCAGG - Intergenic
1141663652 16:85454641-85454663 GTTCCTTGTGGAGGCCCTGGCGG + Intergenic
1141831089 16:86510343-86510365 GCTCCTCGGGGAGGGCGGGCGGG + Intergenic
1142210529 16:88806380-88806402 CTTGCCCGAGGCGGCCCGGCTGG + Intronic
1146821115 17:35984276-35984298 TTCCCTCCAGGAGGCCCTGCTGG + Intronic
1148028597 17:44605046-44605068 GTTCCTTGGGGAGGCCTGGGAGG - Intergenic
1149596774 17:57868819-57868841 GTGGCTCGAGGAGGCTTGGCCGG - Intronic
1150239956 17:63622949-63622971 GCTCCGCGGGGCGGCCCGGCCGG + Intronic
1151197933 17:72445307-72445329 TTTCTTCCAGGAGGCCCTGCTGG + Intergenic
1151699663 17:75736567-75736589 GGTCCTCGCAGAGGCCCGGGTGG - Exonic
1152111723 17:78360552-78360574 GGCCCTCGGGGAGGCCCGGGTGG - Intergenic
1152317726 17:79590611-79590633 TTTCCTGGAGGAGCCCCAGCTGG - Intergenic
1153832419 18:8935479-8935501 GCTCGTCGAGGAGGCTCGGGCGG + Intergenic
1159230846 18:65605558-65605580 GCTCCTCGAGGAGGCTCGGGCGG - Intergenic
1160880148 19:1315989-1316011 GCGCCTCTAGGAGGCCCAGCCGG + Intergenic
1160964483 19:1740514-1740536 GTCCCTGGAAGAGGCCAGGCAGG - Intergenic
1161011507 19:1961479-1961501 GTTTCTCCAGAAGGCCCTGCTGG + Intronic
1161126283 19:2559908-2559930 GTTCCTCCACGAGGCCCTGAGGG + Intronic
1161676428 19:5652899-5652921 GTTCCTCAAGGGGGCCAGGAGGG - Intronic
1161977125 19:7613010-7613032 GGATCTCGATGAGGCCCGGCCGG - Exonic
1162561827 19:11421751-11421773 TTTCCTCCACGAGGCCCAGCAGG + Exonic
1162814683 19:13186761-13186783 GCTCGTCGAGGAGGCTCGGGCGG + Intergenic
1165079066 19:33297511-33297533 GCTCCTGGAGGAGGCCTGGCAGG + Intergenic
1166695399 19:44848857-44848879 ATTCCCCGAGGAGGCCAAGCGGG - Intronic
1166836537 19:45670897-45670919 GTTCCTGGGGGAGGCCTGGGAGG + Intronic
1168099111 19:54131582-54131604 GGTCCTGGGGGAGGCCAGGCCGG - Exonic
1168249085 19:55131083-55131105 TTTCCTCGAGTTGGCCAGGCTGG + Intergenic
1202684842 1_KI270712v1_random:39640-39662 TTTCCTAGAGGAGGCCAGGGAGG + Intergenic
925103958 2:1273107-1273129 GTTCCCCGAGGCGGGCAGGCAGG - Intronic
925128291 2:1477085-1477107 GCTCCCGGAGGAGGCCCGGCCGG + Exonic
927087591 2:19687138-19687160 GTTCCTAGAGAAGGCACAGCAGG + Intergenic
927847202 2:26477665-26477687 GCTCCTCCAGGACGCCCCGCAGG + Exonic
928374555 2:30764251-30764273 CTTCCTCGAGGATGCCCTGGTGG - Exonic
934246877 2:90315206-90315228 TTTCCTAGAGGAGGCCAGGGAGG - Intergenic
934262449 2:91487397-91487419 TTTCCTAGAGGAGGCCAGGGAGG + Intergenic
934305498 2:91818386-91818408 TTTCCTAGAGGAGGCCAGGGAGG + Intergenic
934327758 2:92034362-92034384 TTTCCTAGAGGAGGCCAGGGAGG - Intergenic
934466144 2:94264892-94264914 TTTCCTAGAGGAGGCCAGGGAGG - Intergenic
934560923 2:95312923-95312945 GTCCCGCAAGGAGGCCGGGCTGG + Intronic
934657317 2:96123041-96123063 CTGCCTGGAGGAGGCCAGGCTGG + Intergenic
937919965 2:127122027-127122049 ATTCTTGGAGGAGGCCTGGCTGG + Intergenic
938265272 2:129923615-129923637 GGTCCTCTAGCAGGCCCAGCAGG + Intergenic
942088561 2:172465539-172465561 GTTGCTCGTGGGGGCCCCGCGGG + Exonic
944540112 2:200746487-200746509 ATTCCAGGAGGAGGGCCGGCTGG - Intergenic
944849804 2:203706648-203706670 GTTCCTCGGGGAGGAGGGGCTGG + Exonic
948972861 2:241442755-241442777 GGTCCTCTAGGAGGACTGGCTGG - Intronic
1168936890 20:1673362-1673384 GCTCAGAGAGGAGGCCCGGCTGG + Intergenic
1176064743 20:63188631-63188653 GGTCCTAGAGGAGTCCCGGGAGG - Intergenic
1176123323 20:63463988-63464010 GTTGCTCCAGGAAGTCCGGCGGG - Intronic
1180075499 21:45459540-45459562 TCTCCTCGAGGTGGGCCGGCGGG - Intronic
1180280054 22:10685527-10685549 TTTCCTAGAGGAGGCCAGGGAGG - Intergenic
1180587273 22:16904059-16904081 TTTCCTAGAGGAGGCCAGGGAGG - Intergenic
1181082407 22:20424144-20424166 TGTGCTGGAGGAGGCCCGGCTGG + Intergenic
1184865960 22:47202073-47202095 GGTCCTCGATGAGCCCAGGCTGG + Intergenic
953387289 3:42513817-42513839 GTGCCTGGAGGAGGCCCAGCTGG + Exonic
954405500 3:50342954-50342976 GTTCCACCAGGAGGCAGGGCAGG + Exonic
959580438 3:107977681-107977703 TTTCCTCCAGGAGGTCAGGCAGG + Intergenic
962520718 3:136195782-136195804 GTTCCCCGAGGTGGCGAGGCGGG + Exonic
963171710 3:142257745-142257767 GCTCCTCAAGGAGGCCCAGGTGG - Intergenic
968184339 3:196621609-196621631 GCTCCCCGAGGAAGCCCTGCAGG - Intergenic
992690709 5:79237415-79237437 GTTCCTCGGGGAACACCGGCAGG - Exonic
996716803 5:126594946-126594968 CTCGCTCGAGGAGGCCGGGCGGG - Intronic
997303840 5:132824667-132824689 GTTCCTAGAAGAGGCCCCACTGG - Exonic
997680433 5:135746411-135746433 GTTCCTGGAGGAGGCGTGGGTGG - Intergenic
1003717621 6:8665835-8665857 GCTCGTCGAGGAGGCTCGGGCGG + Intergenic
1003717746 6:8666273-8666295 GCTCGTCGAGGAGGCTCGGGCGG - Intergenic
1005059330 6:21761466-21761488 GTTCGTCGGGGAGGCTCGGGCGG - Intergenic
1006750883 6:36376067-36376089 CTTCTTTGAGGAGGCCCGACGGG - Intronic
1007292140 6:40796012-40796034 GTTCCTCGAGGTGGTCCTGATGG - Intergenic
1019578045 7:1746902-1746924 GATGCTCTGGGAGGCCCGGCAGG - Exonic
1020746964 7:12090842-12090864 GTTCCTGCAGGATGCCAGGCAGG + Intergenic
1022443542 7:30452303-30452325 GTTCCCCGAGCGGGCCCTGCAGG - Exonic
1024575911 7:50764034-50764056 GAACCTGGAGGAGGCCAGGCTGG - Intronic
1029461232 7:100694645-100694667 TTTCCTCCAGGAAGCCCGCCTGG + Intergenic
1031985911 7:128164624-128164646 GTTACATGAGGAGACCCGGCAGG + Intergenic
1033215238 7:139488822-139488844 GTTCCAGGAGGTGGCCCTGCAGG + Intergenic
1034893836 7:154862624-154862646 GTGCCTCGAGGAGCACCTGCAGG + Intronic
1037985814 8:23289969-23289991 GTTCCCCGAGGTGCCCGGGCTGG + Exonic
1039905779 8:41785583-41785605 GTTCTTAGATGAGGCCTGGCTGG + Intronic
1043014424 8:74920533-74920555 GTTCCTGTAGAAGGCCTGGCAGG - Intergenic
1048255581 8:132902768-132902790 GTTCCTGGAGGAGGCCACACCGG - Intronic
1048418449 8:134252529-134252551 GTTCCTTCAGGAGTCCCGTCTGG + Intergenic
1049219622 8:141422945-141422967 GCTCCTCCAGGAGGCCATGCAGG - Intronic
1049689080 8:143950940-143950962 CTTCCTCCAGGACGCCGGGCCGG + Intronic
1049729441 8:144168371-144168393 CTCCCTCGGGGAGGCGCGGCCGG + Exonic
1052379664 9:27756379-27756401 GTTCCTTGAGGAGGCTAGACAGG + Intergenic
1053696195 9:40641664-40641686 TTTCCTAGAGGAGGCCAGGGAGG - Intergenic
1054307442 9:63440883-63440905 TTTCCTAGAGGAGGCCAGGGAGG - Intergenic
1054406174 9:64764894-64764916 TTTCCTAGAGGAGGCCAGGGAGG - Intergenic
1054439802 9:65250367-65250389 TTTCCTAGAGGAGGCCAGGGAGG - Intergenic
1054490605 9:65771572-65771594 TTTCCTAGAGGAGGCCAGGGAGG + Intergenic
1055883402 9:81030701-81030723 GTTCCTTGAGGAGGTCAGACTGG + Intergenic
1056263943 9:84877442-84877464 GTTCCTCAAGGAAACCCTGCTGG + Intronic
1057016415 9:91656630-91656652 GTTCCTGGAGGAGACGCTGCTGG + Intronic
1061943524 9:133895274-133895296 GCTCCTGGGGGAGGCCTGGCGGG + Intronic
1202778644 9_KI270717v1_random:15325-15347 TTTCCTAGAGGAGGCCAGGGAGG - Intergenic
1203585719 Un_KI270747v1:1734-1756 TTTCCTAGAGGAGGCCAGGGAGG - Intergenic
1187186695 X:16993518-16993540 CTTCCTCCAGGAGGCCAGCCAGG - Intronic
1199723776 X:150562749-150562771 CCTCCTTGAGGAGGCCCCGCTGG - Intergenic
1201193950 Y:11473602-11473624 TTTCCTAGAGGAGGCCAGGGAGG - Intergenic