ID: 1125448602

View in Genome Browser
Species Human (GRCh38)
Location 15:39784310-39784332
Sequence GCCATGAAAGCCTATGTTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125448600_1125448602 13 Left 1125448600 15:39784274-39784296 CCACAATCTCATCAGTCAGTCTT No data
Right 1125448602 15:39784310-39784332 GCCATGAAAGCCTATGTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125448602 Original CRISPR GCCATGAAAGCCTATGTTCC TGG Intergenic
No off target data available for this crispr