ID: 1125450147

View in Genome Browser
Species Human (GRCh38)
Location 15:39799544-39799566
Sequence GAGGGAGCCCAGACCCTGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 180}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125450147_1125450156 8 Left 1125450147 15:39799544-39799566 CCCTACAGGGTCTGGGCTCCCTC 0: 1
1: 0
2: 0
3: 17
4: 180
Right 1125450156 15:39799575-39799597 GGGGCCAGTGTGGCCAAAAGAGG 0: 1
1: 0
2: 0
3: 27
4: 266
1125450147_1125450154 -2 Left 1125450147 15:39799544-39799566 CCCTACAGGGTCTGGGCTCCCTC 0: 1
1: 0
2: 0
3: 17
4: 180
Right 1125450154 15:39799565-39799587 TCCAAGAGACGGGGCCAGTGTGG 0: 1
1: 2
2: 1
3: 13
4: 168
1125450147_1125450160 26 Left 1125450147 15:39799544-39799566 CCCTACAGGGTCTGGGCTCCCTC 0: 1
1: 0
2: 0
3: 17
4: 180
Right 1125450160 15:39799593-39799615 AGAGGGCACGAGTTGAGATGTGG 0: 1
1: 0
2: 0
3: 30
4: 344
1125450147_1125450157 9 Left 1125450147 15:39799544-39799566 CCCTACAGGGTCTGGGCTCCCTC 0: 1
1: 0
2: 0
3: 17
4: 180
Right 1125450157 15:39799576-39799598 GGGCCAGTGTGGCCAAAAGAGGG 0: 1
1: 0
2: 1
3: 14
4: 272

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125450147 Original CRISPR GAGGGAGCCCAGACCCTGTA GGG (reversed) Intronic
900332477 1:2142865-2142887 AAGGGGGTCCAGACCCTCTACGG - Intronic
900620739 1:3586603-3586625 AAGGGAGCCCAGAGCCTGGGGGG + Intronic
901741694 1:11345974-11345996 GAGGGAGTCCTGACACTGCAAGG - Intergenic
903375041 1:22860509-22860531 GAGGGAGCCAGGACACTGCAAGG + Intronic
904585947 1:31580627-31580649 AGGGGAGCCAAGACCCAGTATGG - Intronic
904606902 1:31702970-31702992 GGGGGAGGCCAGACGATGTATGG - Intronic
907605959 1:55817620-55817642 GGGTGAGGGCAGACCCTGTAGGG + Intergenic
907641826 1:56198262-56198284 CAGGGAGCCCAGCCACTGAATGG - Intergenic
908913129 1:69096112-69096134 AAGGGAGGGGAGACCCTGTAAGG - Intergenic
913086052 1:115437960-115437982 GAGGAAGCCCAGAGCCCGAAAGG + Intergenic
916422091 1:164647018-164647040 GTGGGACCCCCGAGCCTGTAGGG - Intronic
918071663 1:181137679-181137701 GAAGGAGCCCAGAGCCAGGAAGG - Intergenic
919280309 1:195481915-195481937 GAGGGAGCCAAAAGCCTGAATGG + Intergenic
919801148 1:201355280-201355302 GAGCCAGCCCAGACCCAGCATGG + Intergenic
920006409 1:202836613-202836635 GAAGGAGCCCAGACCTGGTGAGG - Intergenic
1062938498 10:1405061-1405083 GAGGGCTCCCAGAGCCTGTGGGG + Intronic
1067947418 10:50698741-50698763 CAGGGAGGCCAGCCCCTGTGAGG + Intergenic
1070882732 10:79863728-79863750 CAGGGAGGCCAGCCCCTGTGAGG + Intergenic
1071649298 10:87380030-87380052 CAGGGAGGCCAGCCCCTGTGAGG + Intergenic
1072888249 10:99299105-99299127 GAGGGAGCACAGACCTCCTATGG - Intergenic
1072987898 10:100158028-100158050 GGGGGAGCCGAGAGCCTGTATGG + Intronic
1075733701 10:124651506-124651528 CAGGGAGCCCAGCCGCTGGACGG + Intronic
1076239408 10:128892644-128892666 CAAGGAGCCCAGCCCTTGTACGG - Intergenic
1076907123 10:133368392-133368414 GAGGGAGCTGAGACCCTGAGGGG - Intronic
1077167660 11:1151042-1151064 GAGGGAGCTGAGACCCTGCTGGG - Intergenic
1079116137 11:17641749-17641771 GAGGGATCCCAGAGCCTGGAAGG - Intronic
1083380256 11:62261711-62261733 GAGGTGGCCCAGACCCTGGTTGG + Intergenic
1083774625 11:64888408-64888430 GAGGGAGCCTAGACACAGTGGGG - Intergenic
1083890887 11:65595327-65595349 GATGGAGCCCAGGCCCTGTGAGG - Intronic
1084932977 11:72571457-72571479 GAGTGAACCCAGACCATGAAGGG - Intergenic
1085054196 11:73394536-73394558 GAGCGAGGCCAGGCCCTGCACGG - Exonic
1085337472 11:75707063-75707085 GAGGAAGCACAGACCCTCTCTGG - Intergenic
1085464789 11:76716254-76716276 GAGGGAGCCCATAACCTCTTGGG - Intergenic
1089376797 11:118000272-118000294 AAGGGAGCCGAGACCCTGGATGG + Exonic
1089756086 11:120688445-120688467 GAGGCAGCCCAGACACTCAAGGG - Intronic
1090091599 11:123703010-123703032 GAGGCAACACAGACCATGTAAGG + Intergenic
1090390247 11:126383317-126383339 CAGGCAGCCCAGAGCCTCTAAGG - Intronic
1090853045 11:130587337-130587359 GAGGCAGCCCAGGCCATGTGGGG - Intergenic
1091207918 11:133833569-133833591 ACGGGAGCCCAGACCCTCTCGGG - Intergenic
1092275534 12:7058229-7058251 CAGGGACCCTAGAGCCTGTAGGG - Intronic
1096240205 12:49955783-49955805 GAGGGAGCCCTGAGCCTGGCAGG + Exonic
1100382040 12:94071250-94071272 GTGGGGGCCAGGACCCTGTAGGG + Intergenic
1102930894 12:116861394-116861416 GGGGGAGCCCAGAGCTTGAAAGG - Exonic
1103099364 12:118159208-118159230 GAGGGAGCCAAGAAACTTTAAGG - Intronic
1104001428 12:124863283-124863305 GTGGGCGCCCAGACCCTTTAGGG + Intronic
1104386731 12:128357404-128357426 GAGGGAGCCCAGGCCGGGCACGG + Intronic
1106087781 13:26558241-26558263 GAGGGCGCGCAGACACTGAACGG - Intronic
1107646107 13:42495915-42495937 GAGGGTGACCAGACCATGGAAGG - Intergenic
1111193879 13:84846313-84846335 GGGGGAGCCCAGCCTCTTTATGG - Intergenic
1113062083 13:106332774-106332796 GCGGAAGCCCAGACAGTGTATGG - Intergenic
1114590455 14:23860004-23860026 GAGGGAGCCCAGAAAATGGAGGG - Intergenic
1114723455 14:24908500-24908522 TAGTGGGCCCAGACCCTATAAGG - Intronic
1114724828 14:24924765-24924787 GACTGAGCCATGACCCTGTATGG - Intronic
1116658443 14:47677703-47677725 AAAGGAGCCCAGACTCAGTATGG + Intergenic
1116916798 14:50532769-50532791 GAGACAGCCCAGGCCCTGCAAGG - Intronic
1118347452 14:64950471-64950493 GAGGCAGTGCAGACTCTGTAGGG - Intronic
1119549942 14:75501537-75501559 GAGGGAGCCAAGACCAGGCAGGG - Intergenic
1121941685 14:98076670-98076692 CAGGCAGCCCAGACCCCTTAAGG + Intergenic
1121957340 14:98226437-98226459 GAGGCACCCCAGCCCCTGTGAGG - Intergenic
1202905453 14_GL000194v1_random:68925-68947 GGGGGAGCCCAGCCCCTGAACGG - Intergenic
1124436219 15:29651760-29651782 GTGGGTGCCCAAAGCCTGTAGGG - Intergenic
1125450147 15:39799544-39799566 GAGGGAGCCCAGACCCTGTAGGG - Intronic
1125518243 15:40334759-40334781 GAGGGAGGCCAGGCCCTGGGGGG + Exonic
1125887063 15:43237036-43237058 GTGCGACCCCAGACCCTGTCAGG + Intronic
1131777298 15:95816180-95816202 GAGGGAGCCCAGAATCTGCAGGG + Intergenic
1132699799 16:1217506-1217528 CAGGCAGCCCAGTCCCTGCAGGG + Intronic
1132735611 16:1384386-1384408 CTGGGAGCCCAGACCCTGGGGGG - Intronic
1132829137 16:1918920-1918942 GAGGGATCCCAGAACGTGTGGGG + Intergenic
1135908800 16:26540627-26540649 GACTGAGACCAGAGCCTGTAGGG - Intergenic
1136072012 16:27792893-27792915 GAGGGAGCCGAGGCTCTGTAAGG + Intronic
1136082949 16:27864846-27864868 GAAGGAGCCCAGCCCATGTGTGG + Intronic
1136414504 16:30095420-30095442 GAGGGAGCCCAGTGCCTGCCGGG + Exonic
1136461219 16:30411386-30411408 CAGGGAGCCCAGGCCAGGTAGGG + Intronic
1139340363 16:66264316-66264338 GAGGGGGCTCAGCCCCTCTATGG - Intergenic
1140037510 16:71382563-71382585 GATGTAGCCCAGACCCTTCAAGG - Intronic
1140046284 16:71442191-71442213 GAGGTGGCCCAGACCGTGCAGGG + Intergenic
1140546757 16:75817122-75817144 GGAGGACCCTAGACCCTGTAGGG + Intergenic
1140912730 16:79468435-79468457 GAGGGAGCCAAGTCCGTGGAGGG + Intergenic
1142232641 16:88906982-88907004 GTGCTACCCCAGACCCTGTATGG - Intronic
1143201093 17:5114271-5114293 GATGGAGCTCAGACCTTGTGAGG - Intronic
1146507647 17:33419132-33419154 GAGGGAGCCCATGCCTTGTCTGG + Intronic
1150199468 17:63339418-63339440 CAGGCAGCCCAGACCCTGGATGG + Intronic
1151378067 17:73705218-73705240 CATGGGGCCCAGACCCTGCAGGG + Intergenic
1152274678 17:79349339-79349361 GAGTGACCCCAGACCCAGCAAGG - Intronic
1155119814 18:22806904-22806926 CAGGGCACCCAGACCCTGTCTGG - Intronic
1157234888 18:45955062-45955084 GGGAGAGGCCAGACCCTGTGTGG - Exonic
1159458506 18:68693599-68693621 GAGGAAGCCCAGGCACTGTTGGG - Intronic
1160933201 19:1580423-1580445 GAAGGAGCCAAGACCCGGAACGG - Intronic
1161597132 19:5156282-5156304 GAGGGAGCCCAATCCGTGAATGG - Intergenic
1162524931 19:11201604-11201626 GAGGGAGCCCAGATCTAGGAAGG - Intronic
1162817009 19:13201843-13201865 GAGAGAGCCCAGACTGTGCAGGG - Intergenic
1164934621 19:32201355-32201377 GGGAGAGCCCAGAGCCTGCAAGG + Intergenic
1165353913 19:35292127-35292149 GTGGGGGCCTAGACCCTGGAAGG + Exonic
1166299470 19:41905899-41905921 GAGGGAGCTCAGATCCTGCCGGG - Intronic
1167556497 19:50199431-50199453 GAGGGAACCCAGACAGTGAAGGG - Intronic
1167595130 19:50423503-50423525 GAGGGAGACCAGAGCCAGGAGGG + Intronic
925649645 2:6076194-6076216 GAGAGAGCAAAGACACTGTAAGG + Intergenic
926219070 2:10923136-10923158 AAGGGAGCCGAGCCCCTGGATGG - Intergenic
928086593 2:28350013-28350035 GAGGAAGCTCAGGCCCAGTATGG - Intergenic
928369327 2:30729403-30729425 GAGGGAATCGCGACCCTGTACGG + Intronic
929934748 2:46286481-46286503 GAGGGATCCTGGACCCTGGAAGG - Intergenic
932827832 2:74958284-74958306 GAGGGAGGCCCGGCCCTGGAGGG - Intergenic
934677797 2:96261939-96261961 GAGGGAGAACAGACCCTGCCAGG - Intronic
936092436 2:109510165-109510187 GAGGGAGCCCAGAGCAGGTGTGG + Intergenic
938128439 2:128690938-128690960 GATGGAGCCCAGACCATTCAGGG + Intergenic
938298199 2:130191679-130191701 GTGGGACCCCAGAGCCTGCATGG - Intergenic
944887943 2:204084344-204084366 AAGTGAGCCCAGTCCTTGTAGGG + Intergenic
948862802 2:240761048-240761070 GAGGGAGCCCAGACCTGGCCAGG - Intronic
1171328770 20:24318942-24318964 CAGGGAGCCAAGACCCTCCAGGG - Intergenic
1171437883 20:25137052-25137074 GAGGGAGACAAGACATTGTATGG + Intergenic
1171892372 20:30728341-30728363 GGGGGAGCCCAGGCCCTGCACGG + Intergenic
1173142441 20:40495902-40495924 GAAGGAGCCCAGTGCCTGTTGGG + Intergenic
1175416565 20:58805126-58805148 GAGGGAGCCCAGCCCCTCCCTGG + Intergenic
1175475526 20:59271145-59271167 GAGGTCCCCCAGACCCTGTCGGG - Intergenic
1175874670 20:62223717-62223739 GTGGCAGCCCAGACCCTGGTGGG - Intergenic
1176150600 20:63588927-63588949 GGTGGAGCCCAGAGCCTGTCTGG - Exonic
1176624824 21:9083684-9083706 GGGGGAGCCCAGCCCCTGCACGG - Intergenic
1178514699 21:33236664-33236686 GAGGAATCCCAGGCCCTGTCTGG - Intronic
1179675153 21:42975474-42975496 CAGGGCGCCCAGACCCTGCCCGG - Intronic
1179951774 21:44712277-44712299 GAGGGAGCCCAGCCCCTCCTGGG - Intergenic
1180005551 21:45018968-45018990 GAGCGAGCCCGGACCGTGAAGGG + Intergenic
1181181282 22:21070225-21070247 GTGGGACCCCAGAGCCTGCATGG + Intergenic
1182277648 22:29200641-29200663 GAGGGAGGCCAGAGTCTGTGAGG + Intergenic
1182803565 22:33051812-33051834 GAGGGAGCTCAGACAATATAAGG + Intronic
1183415092 22:37677212-37677234 GGGGGCGCCCAGACCCTGCGGGG - Intronic
1184455055 22:44605375-44605397 AAGGGAGCCCAGACGCAGAAAGG + Intergenic
949414434 3:3800003-3800025 GAGGTTCCCCAGACCCCGTAGGG - Intronic
949998142 3:9635303-9635325 CAGTGAGCCCAGACCATGCATGG + Intergenic
950072761 3:10165382-10165404 GTGCGAGCCTCGACCCTGTAGGG + Intronic
950414762 3:12862617-12862639 GAGGAGGCCCAGACCATGTTTGG + Intronic
950657740 3:14447525-14447547 GAGGGAGGCCAGACCCACCACGG - Intronic
954431993 3:50475791-50475813 GTGGGAGCCCAGGCCCAGGAGGG - Intronic
954557589 3:51530514-51530536 GAGGGAGACCAGGCTCTGTGCGG + Intergenic
954813830 3:53264971-53264993 GAGGGAGCCCGAAACCTGCATGG + Intergenic
954943245 3:54393986-54394008 GAAGCATCCTAGACCCTGTATGG - Intronic
955106347 3:55902354-55902376 GAGGGAGCCAAGTCACTGTGGGG - Intronic
955488133 3:59455411-59455433 GAGGAAGCCTAGCCCTTGTAAGG - Intergenic
955924308 3:63990518-63990540 GAGGCAGCACACACTCTGTACGG + Intronic
956184213 3:66547063-66547085 GAGGAAGCCCAGATCACGTAAGG - Intergenic
959966239 3:112358592-112358614 GAGGGAGGGCAGTTCCTGTAAGG + Intronic
962929040 3:140020634-140020656 CAGAGAGCCCAGAGCCTGTCTGG - Intronic
968136973 3:196226863-196226885 GTGGGAGCCTAGATCCAGTAAGG + Intronic
968757355 4:2423658-2423680 GAGGCTGCCCAGACCCTCTGAGG - Intronic
969202701 4:5618398-5618420 GGAAGAGGCCAGACCCTGTAGGG + Intronic
969294904 4:6264013-6264035 GTGGGAGCCCAGAGGCTCTACGG + Intergenic
969431389 4:7156874-7156896 GAGGGAGACTAGACCCTCCAGGG + Intergenic
973623720 4:52751278-52751300 GGGCGAGCCCAGACCCTGCCTGG + Intronic
979499858 4:121427604-121427626 GGGGGAGGCCAGAGTCTGTAGGG - Intergenic
980988353 4:139717478-139717500 GAGGGCGCCCAGCCCCTGCCTGG + Exonic
985810291 5:2078205-2078227 GAGGCAGCCTAGGCCCTGCACGG - Intergenic
988064784 5:26219588-26219610 AAGGGAACCCACACCCTGAAAGG + Intergenic
996907800 5:128621462-128621484 GAGGTAGCAAAGACCTTGTACGG - Intronic
998042735 5:138963157-138963179 GGAGGAGGCCAGACCCTGCAGGG + Intronic
998509345 5:142698445-142698467 ATGGGAGCCCCGACCCTGAAAGG + Intergenic
998529031 5:142868317-142868339 TGGGGAGGCCAGACCCTGCAGGG + Intronic
1000002201 5:157149675-157149697 GACAGAGCCCAGATCCTTTAGGG - Intronic
1002091459 5:176809186-176809208 GATGGAGCCCAGCGTCTGTATGG + Intergenic
1020182727 7:5934742-5934764 GAGGGAACCCAGGCCCAGAAAGG - Intronic
1020259447 7:6522450-6522472 GAGGAATCCCAGACCCTGACAGG - Intronic
1020300185 7:6790015-6790037 GAGGGAACCCAGGCCCAGAAAGG + Intronic
1022665967 7:32410726-32410748 GAGGGAGCACAGCCACTGTCCGG - Intergenic
1022949070 7:35318159-35318181 CAGGGAGCCCAGAGCCAATATGG - Intergenic
1023941223 7:44769333-44769355 GTGGGAGCCCAGAGGCTGCAGGG + Exonic
1031966138 7:128029909-128029931 GAGGGAGCTCAGGCCATGGAAGG + Exonic
1032241133 7:130160192-130160214 GAGGAAGCCCAGGCCCTGTGTGG + Intergenic
1039032514 8:33325756-33325778 GAGAGAGCCCCTACCATGTAAGG - Intergenic
1040418178 8:47214900-47214922 GAGGCACCACAGACCCTGTTTGG - Intergenic
1040423071 8:47259168-47259190 GAGGGAGGCCAGAGCCTTTTAGG + Intergenic
1047495730 8:125407346-125407368 GAGGAAACCCAGACCCTGAGAGG + Intergenic
1048037557 8:130692277-130692299 CAGGGGGCCCAGGCTCTGTATGG + Intergenic
1048259857 8:132936387-132936409 CAGTGAACCCAGGCCCTGTAAGG + Intronic
1053051918 9:34969117-34969139 AAGGGAGGCCAGACCATGCAGGG + Intronic
1053142202 9:35689305-35689327 GAGGGGGCCCAGGCCCAGAATGG + Intronic
1053482336 9:38424646-38424668 GAGGGAACCGAGACCCAGTCGGG + Intergenic
1056198298 9:84249883-84249905 TAGGGTGCCCAGACCCTCTCTGG - Intergenic
1056296843 9:85201747-85201769 GAGAGAGCACACACCCAGTATGG - Intergenic
1057909404 9:99005925-99005947 TAGGTAGGCCAGACCCTGCAAGG - Intronic
1058125871 9:101194334-101194356 GAGGAAGACAAGACCCTGTATGG - Intronic
1058815863 9:108682201-108682223 GAGGGAGACCAGAGAATGTAAGG + Intergenic
1059351788 9:113670638-113670660 CAGGGGGCCCAGACCCCCTAAGG - Intergenic
1060254872 9:122018621-122018643 GAGGGAACCAAGATCCTGTAAGG + Intronic
1060988178 9:127832400-127832422 GAGGGAACCAAGACCCTGAGAGG + Intronic
1062277701 9:135738563-135738585 GAGGGAGCCGGGACCCTGGCTGG - Intronic
1062441032 9:136569283-136569305 GGGGGAGCCCAGAGCATGTGGGG + Intergenic
1062726676 9:138078050-138078072 GAGGGAGCCCGAGCCCTGTGGGG - Intronic
1203747987 Un_GL000218v1:54112-54134 GGGGGAGCCCAGCCCCTGCACGG - Intergenic
1203561737 Un_KI270744v1:63861-63883 GGGGGAGCCCAGCTCCTGCACGG + Intergenic
1187621493 X:21061209-21061231 GTGGCAGCTCAGACCCTGTAGGG + Intergenic
1187652593 X:21425593-21425615 GAGGGAGACCAGAGGCTATAAGG - Intronic
1190044486 X:47101200-47101222 AAGGGTGCCCAGTCCCTTTAGGG + Intergenic
1192169173 X:68843859-68843881 GAGGAAACCGAGACCCTGTGAGG + Intergenic
1192679979 X:73242134-73242156 GGGGGAGCCCAGAGCCTTGAAGG + Intergenic
1196767214 X:119257539-119257561 CAGGGAGTCTAGAACCTGTAAGG - Intergenic
1197657870 X:129137077-129137099 TGGGGAGCCCAGGCCTTGTAGGG + Intergenic
1197704484 X:129623839-129623861 GATGGAGACCAGATCCTGTGGGG + Intergenic
1198734669 X:139772544-139772566 GAGGGAGACTATACCCTGCAAGG + Intronic
1198935972 X:141903288-141903310 CAGGGAGCCCAGACAATGTCAGG + Intergenic
1201161335 Y:11169106-11169128 GGGGGAGCCCAGCCCCTGCACGG - Intergenic